ID: 1059924488

View in Genome Browser
Species Human (GRCh38)
Location 9:119194645-119194667
Sequence ATGGCTAGGGGCCCTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059924488_1059924493 9 Left 1059924488 9:119194645-119194667 CCTGGAGAAGGGCCCCTAGCCAT 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1059924493 9:119194677-119194699 ATCCCTAGCAACAAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059924488 Original CRISPR ATGGCTAGGGGCCCTTCTCC AGG (reversed) Intronic
900089106 1:911638-911660 ATTCCTTGGGTCCCTTCTCCTGG - Intergenic
900090259 1:917203-917225 AGGGCTGGGGAGCCTTCTCCTGG - Intergenic
900156247 1:1204431-1204453 GTGCCTCGGGGACCTTCTCCGGG - Exonic
900363688 1:2301834-2301856 AGGGCAAGGGGCCCTTCACAGGG - Intronic
902927643 1:19707260-19707282 ATGGCTTGGTGCCCTTCTCTTGG + Intronic
903549771 1:24149797-24149819 ATGGCGAGAGGCCCCTCTCTAGG - Intergenic
904390865 1:30184987-30185009 AAGGCTGGTGGTCCTTCTCCAGG - Intergenic
907841307 1:58160240-58160262 ATGGCTCTGGGAACTTCTCCTGG + Intronic
908341027 1:63179315-63179337 CTGGCTAGGGGCTCGTTTCCTGG - Intergenic
915335320 1:155137587-155137609 CCTGCTAGGGGTCCTTCTCCTGG + Exonic
916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG + Intronic
918723131 1:187879754-187879776 TTGGCTAGGGGAGCTTATCCAGG + Intergenic
921398381 1:214693243-214693265 ATGGCTTGGTGCCATTCTCATGG + Intergenic
1062769020 10:85256-85278 TTGGCGAGGGGCCCTGCCCCAGG + Intergenic
1063023935 10:2158713-2158735 ATGGCTTGGGGCTATTGTCCTGG + Intergenic
1063814938 10:9760677-9760699 ATGGCTTGGTGCCCTCCTCGTGG - Intergenic
1065878067 10:30014110-30014132 ATGGCGGGAGGTCCTTCTCCAGG - Exonic
1067277823 10:44850472-44850494 AGGGCCTGGGGCCTTTCTCCTGG - Intergenic
1069903694 10:71720123-71720145 ATGGCTTGTAGCCCCTCTCCAGG - Intronic
1071971533 10:90912788-90912810 ATGGCTAGTGTCTCTTCTCTTGG + Exonic
1072633865 10:97164941-97164963 CAGGCCAGGGGCCCTGCTCCAGG + Intronic
1077215541 11:1393893-1393915 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215576 11:1393999-1394021 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215631 11:1394170-1394192 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215645 11:1394210-1394232 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215677 11:1394303-1394325 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215707 11:1394395-1394417 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215745 11:1394513-1394535 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215791 11:1394657-1394679 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215822 11:1394750-1394772 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215852 11:1394842-1394864 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215886 11:1394947-1394969 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1077215900 11:1394987-1395009 ATCTCCAGGGGCCCATCTCCAGG - Intronic
1078723539 11:13906346-13906368 ATGGCTTGGTGCCATTCTCATGG - Intergenic
1080047675 11:27826622-27826644 ATGGCTGGGAGGCCTCCTCCAGG + Intergenic
1080471131 11:32546636-32546658 ATGGCTTGGTGCCCTTCTCACGG - Intergenic
1084682406 11:70674017-70674039 ATGGCTTGGTTCCATTCTCCCGG + Intronic
1085147090 11:74210545-74210567 ATGGCTTGGTGCCGTTCTCATGG + Intronic
1085558794 11:77450880-77450902 ATCTCTAGAGGCCCTTCTCTGGG + Intronic
1086951751 11:92897735-92897757 GTAGCTAGGGGCCATTCCCCAGG - Intergenic
1088591759 11:111409364-111409386 ATGGCTTGGTGCCATTCTCAAGG + Intronic
1089704162 11:120265372-120265394 AGCGCTAGGGGCCAGTCTCCCGG + Intronic
1090702584 11:129309901-129309923 ATGGCTTGGGGACATCCTCCTGG - Intergenic
1091400123 12:176285-176307 CTGGGGAGGGGCCCTTCCCCAGG - Exonic
1092984330 12:13830995-13831017 ATGGCTTGGTGCCCTCCTCAAGG + Intronic
1093013007 12:14128338-14128360 ATGGCTTGGTGCCATTCTCAAGG - Intergenic
1095542305 12:43324690-43324712 ATGGCTTGGTGACCTTCTCATGG + Intergenic
1099069331 12:78025697-78025719 ATGGCTTGGTGCCATTCTCCTGG + Intronic
1099373317 12:81865552-81865574 ATGGCTAAGAGCCTTTCTACTGG - Intergenic
1099435834 12:82643973-82643995 ATGGCTTGGTGCCCTTCCCATGG - Intergenic
1100039134 12:90291160-90291182 ATGGCTTGGTGCCCTTCTTATGG - Intergenic
1107122408 13:36809929-36809951 ATGGCTTGGTGCCATTCTCAAGG + Intergenic
1107161925 13:37240208-37240230 ATGGCTTGGTGCCATTCTCCAGG - Intergenic
1107606275 13:42060433-42060455 ATGGCTAGGGGACCCCCTACAGG - Intronic
1108769406 13:53680224-53680246 CTGGCTAGGGGCTCATCCCCAGG + Intergenic
1112234485 13:97623445-97623467 ATGGCTTGGTGCCCTTCTCCTGG - Intergenic
1112267550 13:97938902-97938924 ATGGCTTGGTGCCATTCTCTTGG - Intergenic
1114537303 14:23431195-23431217 ATGGCTAGGTGTCTTTCTCTGGG - Intronic
1115597640 14:34924506-34924528 ATGGATTGGTGCCCTCCTCCTGG + Intergenic
1115880644 14:37913841-37913863 ATGGCTTGGTGCCATCCTCCTGG + Intronic
1119263080 14:73249818-73249840 ATGGAGACGGTCCCTTCTCCTGG + Intronic
1120397878 14:83991477-83991499 ATGGCTTGGTGCCCTCCTCATGG - Intergenic
1121452038 14:94014879-94014901 GTGGCTAGAGGCCATTCCCCGGG + Intergenic
1122341144 14:101029294-101029316 ATGACTAGGGGCACTTCCCGTGG + Intergenic
1124416594 15:29477658-29477680 ATGGACAGGGTCCCCTCTCCAGG - Intronic
1124983146 15:34582863-34582885 AGGGGCAGGGCCCCTTCTCCAGG - Intronic
1125321918 15:38498026-38498048 ATGGCTTGGGGTTCCTCTCCTGG + Intronic
1126143778 15:45457716-45457738 AAGGCTAGGGCGCCATCTCCTGG + Intergenic
1127618511 15:60710654-60710676 ATGGCTGGGTGGCCTTCACCTGG + Intronic
1127930423 15:63592960-63592982 GTGGCTAGGGGCCATTGTACTGG - Intronic
1128352436 15:66900111-66900133 ATGGCTGGGGACCCTCCGCCAGG + Intergenic
1128710167 15:69865835-69865857 ATGCTCAGGGGCCCTTCTCTGGG + Intergenic
1129407555 15:75329213-75329235 ATTTCTAGGGGGCCTTCTACTGG - Intergenic
1129497209 15:75995447-75995469 ATGGCTTGGTGCCCTCCTCATGG - Intronic
1129524121 15:76203346-76203368 TTGGCTGGGGGCTCTGCTCCTGG + Intronic
1130538160 15:84801801-84801823 ATGTCTAGGGGCTCATGTCCAGG + Intronic
1130864150 15:87917667-87917689 ATGGCCTGGTGCCATTCTCCAGG + Intronic
1131683709 15:94749985-94750007 AGGGCAAAGGGCCTTTCTCCAGG + Intergenic
1132091559 15:98951571-98951593 CTGGCTTGGAGCCCTTCTCGCGG + Intronic
1132574762 16:659297-659319 ATGGCTTGGGGACCTGCTGCCGG - Exonic
1135907038 16:26521689-26521711 ATGGCTTGGTGCCATTCTCTAGG + Intergenic
1140112181 16:72013727-72013749 ATGTGTAGGGGCCTTCCTCCAGG - Intronic
1142129367 16:88425764-88425786 AGGGAAAGGGGCCCTCCTCCCGG + Intergenic
1142682647 17:1559398-1559420 AGGGCTAGCAGCACTTCTCCAGG + Intronic
1144842388 17:18195514-18195536 ATGGCTTGTGGCTCTTCTCTGGG + Intronic
1146520483 17:33521971-33521993 AGGGCTAGGGGGCCCTCTGCTGG + Intronic
1147322530 17:39654761-39654783 ATGGCAAGGGCCCTTCCTCCAGG + Intronic
1147547445 17:41413466-41413488 CTGGCTAGCTGCCCTTTTCCAGG - Intergenic
1149596399 17:57867147-57867169 AGGGCTAGGGCCCCTTTTCAGGG + Intronic
1151248794 17:72817434-72817456 ATGCCTTGGTGCCATTCTCCTGG - Intronic
1152609773 17:81309859-81309881 TAGGCTGGGGGCCCTGCTCCGGG + Intergenic
1153770047 18:8408086-8408108 ATGGCGAGGGGCCATCCTCCAGG - Intergenic
1156921989 18:42533259-42533281 ATGGCAGGGGGCCCATCTCTTGG - Intergenic
1156991014 18:43407592-43407614 TTGGCTAGGGGACTTTATCCAGG - Intergenic
1157160318 18:45308086-45308108 ATGGCTTGGTGCCCTCCTCGTGG - Intronic
1161044490 19:2127922-2127944 ATGGCGCGTGGCCATTCTCCTGG - Intronic
1163086592 19:14985382-14985404 ATGGCTTGCTGCCATTCTCCTGG + Intronic
1163379049 19:16952221-16952243 ATGATGGGGGGCCCTTCTCCAGG + Intronic
1164530371 19:29043899-29043921 ATGGCTTGGTGCCATCCTCCTGG - Intergenic
1164583294 19:29448557-29448579 ATGGCTTGGTGCCCTCCTCGTGG + Intergenic
1165722280 19:38088076-38088098 ATGCCTAGGGGCCCCTATCGTGG + Intronic
925308704 2:2866775-2866797 AGGGCCATGGCCCCTTCTCCAGG - Intergenic
925655169 2:6139153-6139175 ATGGCTTGGTGCCATTCTCAGGG + Intergenic
925813398 2:7723649-7723671 ATGTCTGGGTGCCCTTTTCCAGG - Intergenic
926918826 2:17918991-17919013 AGGGCTAGGGGCCCCTCTTGTGG + Intronic
929875362 2:45792272-45792294 ATGGCTTGGTGCCATTCTCATGG - Intronic
932550657 2:72766123-72766145 ATGACTAGGAGCCCTTCCCTTGG - Intronic
934560382 2:95310201-95310223 ATGCCTAGTGCCCCTTGTCCTGG - Intronic
934859468 2:97751887-97751909 ATGGCTTGGTGCCATTCTCATGG - Intergenic
935062515 2:99620766-99620788 ATGGCTTGGTGCCCTCCCCCAGG + Intronic
941140832 2:161779242-161779264 ATGGCTTGGTGCCCTTCTCATGG - Intronic
942799606 2:179860963-179860985 ATGGCCAGGAGCCCCCCTCCCGG - Intronic
943204452 2:184875325-184875347 ATGGCTTGGTGCCATTCTCATGG + Intronic
946801397 2:223419856-223419878 ATGGCTTGGAGCCCTTCACATGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948455701 2:238103714-238103736 ATGCCTTGGTGCCCTTCTCAGGG - Intronic
1170008129 20:11691090-11691112 ATAGCTAAGGGCAGTTCTCCGGG - Intergenic
1171169839 20:23006304-23006326 TTGGCTAGGGGGCCTTATCATGG - Intergenic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1171420381 20:25013772-25013794 GTGGCTTGGGGCCCTCCTCAGGG - Intronic
1171420501 20:25014296-25014318 ATGGCGAGGGGGCCTGCACCTGG - Intronic
1171433504 20:25102427-25102449 ATGGCTTGGTGCTCTCCTCCTGG - Intergenic
1173319514 20:41974829-41974851 ATGGCTGGGTGCCCTACTCTTGG - Intergenic
1174267990 20:49345781-49345803 AATGCCACGGGCCCTTCTCCGGG + Intergenic
1174356880 20:50004627-50004649 AGGGCTAGGGTCACTTCTGCTGG + Intergenic
1174433630 20:50489647-50489669 ATGGCTTGGGGCCCTCCCCATGG + Intergenic
1175662892 20:60832271-60832293 CTTGCTAAGGCCCCTTCTCCTGG + Intergenic
1175995889 20:62812178-62812200 ATGGCTGGGGCCCCTCCTGCTGG - Intronic
1177106213 21:16958665-16958687 GTGGCTTGGGGCTCTTCCCCTGG - Intergenic
1177188282 21:17821514-17821536 ATGGCTTGGTGCCATTCTCTAGG - Intergenic
1177726101 21:24970426-24970448 ATGGCTTAGTGCCCTTCTCATGG - Intergenic
1180056204 21:45360380-45360402 ATCCTTAGGGGCCCTTATCCAGG + Intergenic
1182476365 22:30578747-30578769 GTGGCTTGGGGCCCTCCTCTAGG - Intronic
1183346934 22:37313157-37313179 ATGTCTCTGGGCCCCTCTCCAGG - Intronic
1183682504 22:39341317-39341339 ATGTCTAGGGCCCCTTCCCATGG + Intergenic
1184870210 22:47232998-47233020 ATGCCTAGGGCCCATTCCCCAGG - Intergenic
952835948 3:37602048-37602070 ATGGCTTGGTGCCATTCTCTAGG - Intronic
954199975 3:49018348-49018370 ACGGCACGGGGCCCATCTCCCGG + Intronic
955067868 3:55547969-55547991 AGGGCCAGGGGGCCTTCTTCAGG + Intronic
955153083 3:56388262-56388284 ATGTCTTGGTGCCATTCTCCGGG + Intronic
955312551 3:57903939-57903961 ATGGCTTGGGTCCATTCTCAAGG - Intronic
955437852 3:58922471-58922493 ATGGCTTGGTGCCATTCTCACGG + Intronic
955689275 3:61574938-61574960 ATGGCTTGGTGCCATTCTCGAGG - Intronic
957305350 3:78450909-78450931 ATGGCTTGGTGCCCTCCTCATGG - Intergenic
957899762 3:86474010-86474032 ATGGCTTGGTGCCCTCCTCATGG + Intergenic
958074562 3:88658617-88658639 CTGGCTAGGGGTCCACCTCCAGG - Intergenic
959375243 3:105581544-105581566 TTGGCTAGGAGCTCTGCTCCAGG - Intergenic
959422260 3:106143383-106143405 ATGGCTTGGTGCCATTCTCATGG + Intergenic
960523343 3:118681145-118681167 ATGGCTTGGGACCATTCTCATGG + Intergenic
960583396 3:119299280-119299302 ATGGCTAAGGCCGCTTATCCAGG - Intronic
961043440 3:123693363-123693385 GAGGCTAGGAGCCCTTGTCCAGG + Intronic
961332830 3:126153188-126153210 CTGGCTAGGCACCCATCTCCAGG - Intronic
962372808 3:134834708-134834730 ATGGCCAGGAGACCTTCACCTGG - Intronic
962417800 3:135199618-135199640 ATGTTTGGGGGCCCTTCTACTGG + Intronic
963041399 3:141072436-141072458 ATGGCTTGGTGCCCTCCTCGTGG + Intronic
965672710 3:171162998-171163020 AAGGTCAGTGGCCCTTCTCCAGG + Intronic
966294225 3:178400182-178400204 ATGGCTTGGTGCCCTTCCCTTGG + Intergenic
967880003 3:194295061-194295083 CTGGCTAGGGGCTCCTCTCTGGG + Intergenic
968087872 3:195882050-195882072 ATCGCAAGGTGCCCTTCGCCTGG - Exonic
969592979 4:8132466-8132488 AGGGCTGGGCGTCCTTCTCCAGG - Intronic
970643248 4:18090664-18090686 ATGGCAGGTGCCCCTTCTCCAGG - Intergenic
975684356 4:76904868-76904890 ATGGCTTGGTGCCTTTCTCATGG + Intergenic
979640505 4:123008308-123008330 ATGGCTTGGTGCCATTCTCCAGG - Intronic
979649688 4:123115105-123115127 ATGGCCTGGAGCCCTGCTCCAGG - Intronic
980804376 4:137792935-137792957 ATGGCTTGGGGTCCTTCCCATGG - Intergenic
982871896 4:160590131-160590153 ATAGCTTGGTGCCATTCTCCTGG - Intergenic
984870205 4:184318452-184318474 ATGGCTTGGTGCCCTCCTCATGG + Intergenic
987183231 5:15387743-15387765 ATGGCTTGGTGCCCTTCCCATGG - Intergenic
988086701 5:26483734-26483756 CTGGCTAGGGCTCCATCTCCAGG + Intergenic
989214692 5:38892199-38892221 TAGGCTATGGGCCCTTCACCAGG - Intronic
989539920 5:42606582-42606604 ATGGCTTGGTGCCCTTGTCAGGG - Intronic
991432093 5:66559024-66559046 ATAGCTAGGGGACCTTTTCTGGG - Intergenic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
993446616 5:88020503-88020525 ATGGCTTGGTGCCCTTCCCATGG - Intergenic
995905862 5:117121832-117121854 ATGCCTATGGGCACTTCTCATGG - Intergenic
999760739 5:154699053-154699075 ATCTCCAGGGGCCCTTTTCCAGG - Intergenic
1000031045 5:157401679-157401701 ATGGCTGGTGGCCCTGCTACTGG - Intronic
1000452140 5:161402768-161402790 ATTGCTGGGGCCCCATCTCCAGG - Intronic
1000594731 5:163201901-163201923 ATGGCTTGGTGCCCTTCCCATGG + Intergenic
1001838925 5:174856699-174856721 ATGGCTTGGTGCCCTTCTCATGG - Intergenic
1007251792 6:40500246-40500268 AGGGCAAGGGGGCCTTCCCCTGG - Intronic
1007399644 6:41596493-41596515 ATGCCTAGGGGCCAGTCTCCAGG + Intronic
1009667443 6:66702864-66702886 CTGGCTAAGGGCCATTCCCCGGG + Intergenic
1012001100 6:93656263-93656285 GTGGCTTGGTGCCATTCTCCTGG - Intergenic
1013590045 6:111612333-111612355 TTGGATAAGGGCCCTTCTCAGGG - Intergenic
1013904623 6:115200207-115200229 ATGGCTTGGTGCCCTCCTCTTGG - Intergenic
1014266640 6:119285337-119285359 ATGGCTTGGTGCCTTCCTCCAGG - Intronic
1016354161 6:143199962-143199984 TTGGCTTGGAGCCTTTCTCCTGG - Intronic
1017034245 6:150252635-150252657 ATGGCTTGGTGCCATTCTCCTGG + Intergenic
1017325444 6:153136430-153136452 ATGGCTTGGTGCAGTTCTCCAGG + Intergenic
1018378346 6:163234278-163234300 ATGGCTTGGTGCCATTCTCAGGG + Intronic
1019622838 7:2000993-2001015 ATGGTTACAGGCCCTTCTCATGG - Intronic
1024797772 7:53038249-53038271 ATGGCTTGGGGCCATTCCCTTGG - Intergenic
1026560337 7:71443449-71443471 ATGGCTTGGTGCCCTCCTCCTGG + Intronic
1026680966 7:72466367-72466389 GTGGCTGGGGGTCTTTCTCCAGG - Intergenic
1029664163 7:101983767-101983789 ATGGCTTGGTGCCCACCTCCTGG - Intronic
1029687091 7:102156502-102156524 ATGGCTTGGTGCCATTCTCCTGG - Intronic
1029688737 7:102166337-102166359 TTGGCGAGGGGCCGTTCTCATGG + Intronic
1031193999 7:118589553-118589575 ATGACTTGGTGCCCTGCTCCTGG - Intergenic
1032428703 7:131843124-131843146 AAGCCTGGGGGCCCTGCTCCAGG - Intergenic
1033973272 7:147069122-147069144 ATGGCTCTGTGCCCTTCCCCGGG - Intronic
1035022284 7:155806787-155806809 AGAGCTGGGGGCCTTTCTCCAGG + Intronic
1035699529 8:1627372-1627394 GTGCCCAGGGACCCTTCTCCTGG - Intronic
1036116295 8:5963794-5963816 ATGGCTCCTGGCCCTTCTGCAGG - Intergenic
1036825867 8:11975423-11975445 AGGCCTAAGGGCCCTTCTCCAGG - Intergenic
1037743591 8:21626390-21626412 AGGGCCAGGGACCTTTCTCCAGG + Intergenic
1039737603 8:40349223-40349245 ATGGCTTGGTGCCATTCTCCTGG + Intergenic
1041246350 8:55892052-55892074 ATGGAGAAGGACCCTTCTCCAGG - Intronic
1041598791 8:59690465-59690487 ATGGCTTGGTGCCCTCCTCATGG + Intergenic
1043641213 8:82452460-82452482 ATGGGCAGGGGCCCCTCTGCTGG + Intergenic
1048291790 8:133186787-133186809 ATGCCTATGGGCCCGACTCCTGG + Intergenic
1052698188 9:31905911-31905933 ATGGCTTGGTGCCCTCCTCCTGG + Intergenic
1056709955 9:88984188-88984210 ATGGCTGGGGTGCCTTGTCCAGG - Intergenic
1058234359 9:102470814-102470836 ATGGCTTGGTGCCCTCCTCATGG - Intergenic
1058603293 9:106694231-106694253 ATGACTAGGAGCCCATGTCCTGG - Intergenic
1059040636 9:110812044-110812066 CTTGCTAGGTGCCCTTTTCCTGG - Intergenic
1059705719 9:116821505-116821527 CTGGCTAGGAGCCCTTTTCATGG - Intronic
1059924488 9:119194645-119194667 ATGGCTAGGGGCCCTTCTCCAGG - Intronic
1062388744 9:136325784-136325806 ATTGCTGGGGGAGCTTCTCCTGG - Intergenic
1062524139 9:136971546-136971568 TTGGCCTGGGTCCCTTCTCCTGG - Exonic
1186432141 X:9513984-9514006 ATGGCTTGGTGCCCTCCCCCTGG - Intronic
1187289554 X:17939974-17939996 ATGGCTTGGTGCCATTCTCAAGG + Intergenic
1188095535 X:26016834-26016856 ATGGCTTGGTGCCCTTCTCATGG - Intergenic
1189286632 X:39856289-39856311 GTGGCTAGTGGCCCCTGTCCTGG - Intergenic
1190547781 X:51547101-51547123 ATGGCTTGGTGCCATTCTCATGG - Intergenic
1195410938 X:104567251-104567273 AAGGCCAGGGGCTCTTCGCCTGG + Intronic
1196413868 X:115449812-115449834 ATGGCTTGGTGCCCTTCTAGAGG + Intergenic
1199355075 X:146853043-146853065 ATGGCTTGGTGCCATTCTCATGG + Intergenic
1199836444 X:151596422-151596444 ATGGCTTGGTGCCATTCTCCTGG - Intronic