ID: 1059927341

View in Genome Browser
Species Human (GRCh38)
Location 9:119223427-119223449
Sequence CACATAAGACTTCTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059927341_1059927345 0 Left 1059927341 9:119223427-119223449 CCTTTCTCCAGAAGTCTTATGTG 0: 1
1: 0
2: 1
3: 24
4: 169
Right 1059927345 9:119223450-119223472 GTCTCAGGTAGTCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059927341 Original CRISPR CACATAAGACTTCTGGAGAA AGG (reversed) Intronic
901213103 1:7537476-7537498 CACAGACGCCTTTTGGAGAAGGG - Intronic
901249186 1:7760703-7760725 CAAATGAGATTTCTGGAAAATGG + Intronic
901850599 1:12012465-12012487 CACACAGGACAGCTGGAGAATGG + Exonic
902255521 1:15186571-15186593 CACTTAAGACATCTGTAGAATGG + Intronic
902713683 1:18257880-18257902 CTCAGAAGACTTCAGGTGAAGGG - Intronic
903764084 1:25721855-25721877 CACATCACACTTATGGGGAAAGG - Intronic
906057006 1:42925055-42925077 CCCAAAAGACTTCTGTTGAAAGG - Intergenic
906672803 1:47669058-47669080 CAGATAAGACATCTGGAAGATGG + Intergenic
913036944 1:114977380-114977402 CAAATAATACCTCTGTAGAAAGG + Intronic
916462495 1:165041286-165041308 AACACAAGACATTTGGAGAAAGG + Intergenic
919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG + Intergenic
919480757 1:198085771-198085793 CACCTCAGACTTCTTGTGAATGG - Intergenic
921415696 1:214884110-214884132 CAAATAAGATTTGTGCAGAATGG + Intergenic
921788048 1:219256399-219256421 CAAATTAGCCTTCTGGAAAAAGG - Intergenic
923775973 1:236978759-236978781 CACATCAGAAGTCTGGAGATTGG + Intergenic
1064340506 10:14481261-14481283 GCCATTTGACTTCTGGAGAATGG - Intergenic
1067366539 10:45635778-45635800 GACAAAAAACTTCTGGAGATTGG + Intronic
1068304694 10:55192276-55192298 AACATAAGCCATCTGGAGAATGG - Intronic
1068870218 10:61935364-61935386 TACATAAGAACTCTGCAGAAAGG + Intronic
1068995861 10:63202714-63202736 TACATAAGTCTTCTGGAAATGGG - Intronic
1072152907 10:92697281-92697303 CATATCAGATTTTTGGAGAATGG + Intergenic
1074507452 10:114084319-114084341 AACTTCAGACTTCTGGAGCAAGG + Intergenic
1074536862 10:114334289-114334311 CTCTGAAGACTTCTGAAGAAAGG - Intronic
1074684252 10:115944715-115944737 AAGATAAGACTTCTGGAGTCCGG + Exonic
1076253878 10:129004744-129004766 CACAGAAGCATTCTGAAGAAGGG + Intergenic
1078067470 11:8087837-8087859 CAGTGAAGACTTCTGAAGAAAGG - Intronic
1078736051 11:14021948-14021970 CACAAAAGACTTAAGGACAATGG - Intronic
1078904051 11:15667870-15667892 CTCAGAAGAGTTCTTGAGAATGG - Intergenic
1079615630 11:22489162-22489184 CATCTAAGACTTCTCTAGAATGG - Intergenic
1081703864 11:45168922-45168944 CAAATAAGAATTGGGGAGAAGGG - Intronic
1081903009 11:46645973-46645995 CACTTAAGACTTCTGAGGTAAGG + Exonic
1084712185 11:70850735-70850757 CCCATCAGACTGCTGGCGAATGG + Intronic
1087333227 11:96810742-96810764 CACATAAGTTTCCTGGAGAGTGG + Intergenic
1087703236 11:101461186-101461208 CACATAAGAAAACTGGAGTAAGG - Intronic
1088029534 11:105229551-105229573 AAAATTAGACATCTGGAGAAAGG - Intergenic
1089594421 11:119568101-119568123 CACAGACGATTTCTGGAAAATGG - Intergenic
1091533973 12:1388025-1388047 CAAATAATATTTTTGGAGAAAGG + Intronic
1091808756 12:3377347-3377369 TACATGAGACTTCTGGAGAGAGG + Intergenic
1093960123 12:25263474-25263496 CACTTATGATTTCTGAAGAAGGG - Intergenic
1095034600 12:37345266-37345288 CACAAAAGAGTTCCTGAGAATGG + Intergenic
1095044799 12:37490151-37490173 CACATAGGAAGTCTGGAGACAGG - Intergenic
1095748800 12:45688617-45688639 CACATAAGACATTTGGGTAAAGG - Intergenic
1096692105 12:53327697-53327719 GAAAAAAGAGTTCTGGAGAATGG + Exonic
1097309360 12:58101763-58101785 GACATGAGCCTTCTGGAGCAGGG + Intergenic
1097397736 12:59096356-59096378 AAATTAAGACATCTGGAGAAAGG + Intergenic
1099769889 12:87037911-87037933 CAAATAATACTTCTAAAGAACGG + Intergenic
1100113057 12:91269193-91269215 CACATAAGTCTTCATGAAAAAGG + Intergenic
1103083465 12:118043446-118043468 CACGTAAGACTTTTGGGGAGTGG + Intronic
1108411264 13:50149780-50149802 AAAATAAGACTTATGAAGAAAGG + Intronic
1108452690 13:50583214-50583236 CATATAAGACTTTTCAAGAATGG + Intronic
1109227930 13:59719425-59719447 CACTTAAAACTTATGGAGAGAGG + Intronic
1111611730 13:90615130-90615152 TACATATGTCCTCTGGAGAAGGG + Intergenic
1111657102 13:91167454-91167476 CACATTAGACTTCTGATGATGGG - Intergenic
1111920517 13:94405331-94405353 CACATAAGACTTCTCTATGAAGG + Exonic
1112039244 13:95529639-95529661 TACAAAAGACTTTTGGGGAATGG - Intronic
1112460554 13:99600280-99600302 AACATAAGACTTTTGGGGGAAGG - Intergenic
1112686395 13:101832781-101832803 GACATAAGAATTCTCGAGAAAGG + Intronic
1115080549 14:29445626-29445648 CACATAACACTGGTGGAAAACGG + Intergenic
1115469937 14:33758074-33758096 CACAGAAGAATTCTGAAGAAAGG - Intronic
1118038444 14:61892734-61892756 TACATCAGAGTGCTGGAGAAGGG + Intergenic
1118095648 14:62534355-62534377 CATATCAGACTTCAGAAGAAGGG + Intergenic
1118373556 14:65157826-65157848 CATCTAAGCCTTATGGAGAATGG + Intergenic
1123509564 15:20983118-20983140 CATAAAAGGCTTCTTGAGAAAGG - Intergenic
1123566786 15:21556857-21556879 CATAAAAGGCTTCTTGAGAAAGG - Intergenic
1123603047 15:21994150-21994172 CATAAAAGGCTTCTTGAGAAAGG - Intergenic
1123783956 15:23650151-23650173 CACAAAAAGCTTCTGCAGAATGG + Intergenic
1124822887 15:33065229-33065251 CACGTTACACTTCTGGAAAAGGG - Intronic
1126130396 15:45335391-45335413 CAAATAAGACCTCTGGAGATGGG + Intergenic
1126689547 15:51278628-51278650 CACATAAAACATCTGGCTAAAGG - Intronic
1129923127 15:79337685-79337707 CACAGAAGATTCCTGGAGTATGG + Intronic
1130879166 15:88040370-88040392 CACCAAAGGCTTCTGCAGAATGG - Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1202975147 15_KI270727v1_random:283952-283974 CATAAAAGGCTTCTTGAGAAAGG - Intergenic
1139184823 16:64793592-64793614 CAAAACAGACTTCTTGAGAATGG + Intergenic
1142481080 17:218613-218635 CACAAAGGACTTCTGGGAAAAGG - Intronic
1146995314 17:37315317-37315339 GACATAAGACATCTGTAAAATGG - Intronic
1147769925 17:42860408-42860430 CACAGAGGACTTCTGGAGAGAGG - Intergenic
1151978419 17:77495286-77495308 CATATAAGACTGCTGGAAAGTGG - Intronic
1152444054 17:80330411-80330433 GACAGAAGACTTCAGGAGACAGG - Intronic
1152464224 17:80456698-80456720 CACATCAGACATCCGGGGAATGG + Intergenic
1153762308 18:8343439-8343461 CATCTATGACTTCTGGAGGATGG + Exonic
1155845601 18:30702078-30702100 CACAAAAAGCCTCTGGAGAATGG + Intergenic
1155871796 18:31039491-31039513 GCCATAAGTCTTCTGCAGAATGG + Intronic
1160100301 18:75914700-75914722 CACAAAAGGCTTCTGTAGTAAGG - Intergenic
1160136741 18:76278310-76278332 CACATAAAAATTTTGGATAATGG + Intergenic
1162865072 19:13539712-13539734 CACATAAGACTTCTTGAGGCTGG + Intronic
925634507 2:5929978-5930000 CACATAAAAATTCTATAGAAAGG + Intergenic
927611100 2:24541437-24541459 CACATAACAGATCTGGAGGAAGG - Intronic
928875210 2:36030453-36030475 TACATAAGACATATGCAGAAAGG + Intergenic
930614168 2:53576253-53576275 CACATCTGACAGCTGGAGAAAGG - Intronic
930711626 2:54555894-54555916 CACATCTGCCTTTTGGAGAAAGG - Intronic
931824717 2:65988489-65988511 CTCATCAGACTTCTTGAGGAAGG + Intergenic
932113330 2:69021813-69021835 GAGATAAGACTTCTGGAGAAAGG + Intronic
932996707 2:76864134-76864156 CACATTAAAATACTGGAGAAAGG - Intronic
933021174 2:77194275-77194297 CACATAAGAGTTGTGAAGATAGG - Intronic
936039671 2:109140721-109140743 CACATAGGCCTTTTGCAGAAGGG - Intronic
936561715 2:113544309-113544331 GCCATAAGGCTTCAGGAGAAAGG + Intergenic
936989418 2:118346719-118346741 CACATAAGGCAGCTGGAGATGGG - Intergenic
938064354 2:128273044-128273066 CACATAACCCTTCTGGACCAAGG + Intronic
938979414 2:136511616-136511638 CAAACAAGATTTCTGGGGAAAGG - Intergenic
938998208 2:136703166-136703188 CACATAAGAGCTGTGTAGAAAGG - Intergenic
939140170 2:138345175-138345197 CAAGTAAGACTTATGGAGAAAGG + Intergenic
939659980 2:144877363-144877385 CAAATAAGACTTTTGTATAAAGG + Intergenic
940745089 2:157558322-157558344 CAAAGAGGACATCTGGAGAATGG - Intronic
942465448 2:176203069-176203091 ATCATAAGATTTCTGGAGAAGGG + Intergenic
943162479 2:184271826-184271848 CAAATCATACTTCTGGATAAAGG - Intergenic
943233153 2:185283193-185283215 TTCTTAAAACTTCTGGAGAAGGG + Intergenic
943626408 2:190206047-190206069 CACATAATTCTTGTGAAGAATGG + Intronic
944140974 2:196456505-196456527 ACCATATGTCTTCTGGAGAAAGG + Intronic
944260335 2:197669204-197669226 AACATAAGACTTCAGGAGTTTGG - Intronic
946620695 2:221559720-221559742 CACATCAGACTGTTGGAAAAAGG - Intronic
1169851661 20:10058944-10058966 CATACAACACTTCTGGAGAAGGG - Intergenic
1171164966 20:22961736-22961758 CACATAAGAATTCTTTAGAATGG + Intergenic
1171539340 20:25933775-25933797 CACATAGGAAGTCTGGAGACAGG - Intergenic
1171801696 20:29626484-29626506 CACATAGGAAGTCTGGAGACAGG + Intergenic
1172289015 20:33761906-33761928 AACATTAGACTTCTGGGCAAAGG - Exonic
1175497193 20:59423267-59423289 CAGAGAAGTCTTCAGGAGAAGGG + Intergenic
1177183389 21:17767361-17767383 AACATAAGAATTTTGGAGAGTGG + Intergenic
1183817650 22:40316744-40316766 CACAGTCTACTTCTGGAGAAGGG + Intronic
950324513 3:12093820-12093842 CTTATAAGACTTTTAGAGAAAGG - Intronic
951264481 3:20550208-20550230 CATATAAGAATTTTGGAGATGGG - Intergenic
955596625 3:60597501-60597523 TACATGAGTCTTTTGGAGAATGG - Intronic
956017180 3:64895888-64895910 CACATAAGATTTCTGAAAATAGG - Intergenic
956883434 3:73534486-73534508 CACTTAAGAGTTCTGGTGAAAGG + Intronic
958000634 3:87744335-87744357 CACATAATACTTGTGAATAATGG - Intergenic
960520663 3:118651366-118651388 CCCTTAAAACTTCTGTAGAAAGG - Intergenic
963501342 3:146131067-146131089 CCCATAACTTTTCTGGAGAATGG - Intronic
964291714 3:155188425-155188447 CAAACCACACTTCTGGAGAATGG + Intergenic
966338541 3:178899251-178899273 CACATAAGGCTTCTGGCCATGGG - Intergenic
967048262 3:185757396-185757418 CAGATATGACTCATGGAGAAAGG - Intronic
970741158 4:19239245-19239267 CTCATGAGAATTCTGCAGAATGG + Intergenic
970923107 4:21418196-21418218 GACATAAGACTTCTGGATCATGG + Intronic
973964695 4:56149517-56149539 CACATAAAACTCCTGAAAAATGG + Intergenic
974234455 4:59162692-59162714 CTCATAAGACTTCTGCTGAGAGG - Intergenic
976002378 4:80387666-80387688 AACATTAGACTTCTGGGCAAAGG + Intronic
977024086 4:91793325-91793347 CACATAAAACTTCAGCAAAAGGG - Intergenic
977088752 4:92641792-92641814 CACTGAAGACTACTGGAGGAGGG - Intronic
977101161 4:92816718-92816740 TACATAACTCTTCTGGAAAATGG + Intronic
980990771 4:139736514-139736536 CTCATAAGACTCCTTGACAATGG + Intronic
981046671 4:140271146-140271168 CACAGAAGACTTGTGGAAAAGGG + Intronic
987105795 5:14637691-14637713 CACATGAGAATTCTCCAGAAGGG - Intergenic
988542867 5:32128042-32128064 CAAAGCAGACTACTGGAGAAGGG + Intronic
990507065 5:56455538-56455560 CACTTAAGACTCCTAGAGTATGG - Intergenic
990627641 5:57632473-57632495 CACATAGGACATCTAAAGAAAGG + Intergenic
991182120 5:63764650-63764672 CACACGAGAGTTCTGGAGAATGG - Intergenic
992167000 5:74063242-74063264 AAAATAAAAGTTCTGGAGAAAGG - Intergenic
996035948 5:118759026-118759048 CAGAGATGACCTCTGGAGAAGGG + Intergenic
996974042 5:129408965-129408987 GGCAAAAGAATTCTGGAGAAAGG - Intergenic
997891831 5:137683697-137683719 CACATAATATTTCTGGAGTAAGG - Intronic
997913676 5:137902149-137902171 GACATTAGACATCTGGAGAAGGG + Intronic
998315462 5:141179206-141179228 CACAGAAGATTTCAGGAGGAAGG - Exonic
999371529 5:151058223-151058245 CACATGTGTCTTCTGGGGAATGG + Intronic
1003665955 6:8111540-8111562 CACAGAGCACTTCTGGGGAAGGG - Intergenic
1003937434 6:10989979-10990001 CAAATAAGATTTCTGGATGAGGG - Intronic
1008925747 6:56890713-56890735 CACATAACACTTCAAGAGGATGG + Intronic
1010206712 6:73328871-73328893 GACCTAATCCTTCTGGAGAAAGG - Intergenic
1011351612 6:86430110-86430132 CACTTAAGAGTTCTGGAGTCAGG + Intergenic
1013046656 6:106492463-106492485 GCCATAATACTTCTGAAGAAAGG + Intergenic
1013752398 6:113422502-113422524 CCCTAAAGACTTCAGGAGAAGGG - Intergenic
1014423641 6:121274696-121274718 CAAAAAAGACTTCTAGAAAAAGG + Intronic
1018107124 6:160499682-160499704 CACATAGCACTGCTGGAGACTGG - Intergenic
1019023479 6:168939007-168939029 CACTTAACTCTTCTGGAGGACGG - Intergenic
1020152828 7:5696717-5696739 CACCTAGGTCTTCTGGAAAATGG + Intronic
1021427720 7:20521705-20521727 CTCAGAAGACTTCTGGCTAAGGG + Intergenic
1021702109 7:23329635-23329657 CACATAAGAGTAGTGGAGATGGG + Intronic
1023326732 7:39069008-39069030 CACATAAAAATTGTGGAGAGTGG + Intronic
1024522845 7:50321889-50321911 TACATAAGACTTCCTGAAAAAGG + Intronic
1025290725 7:57719699-57719721 CACATAGGAAGTCTGGAGACAGG - Intergenic
1031130423 7:117827191-117827213 AAAATAAGGCTTCTGAAGAAGGG + Intronic
1031131761 7:117841182-117841204 CACAGAAGACATCTGGAGTCTGG + Intronic
1033630364 7:143151759-143151781 CAAAGAAGACCTCTGGAGAAGGG - Intergenic
1034781315 7:153885345-153885367 CACATATGAATTCTGGAAAAGGG - Intergenic
1035834828 8:2738804-2738826 CACATAAGACGTATAGAAAATGG + Intergenic
1038365748 8:26931825-26931847 CAAATAAAAATTCTGGAGAATGG + Intergenic
1042067796 8:64898000-64898022 CACATATGACTTTTGGGGAAAGG + Intergenic
1042488331 8:69371058-69371080 CTCACAGGACTCCTGGAGAAAGG - Intergenic
1044251750 8:90010643-90010665 CACATAAGAGTTTTGCAGACTGG - Intronic
1044740380 8:95320589-95320611 CCCAAAAAACTTGTGGAGAATGG - Intergenic
1047348852 8:124054231-124054253 CACTGAAGATTTCTGGAGAGAGG - Intronic
1048500154 8:134968166-134968188 CTCATCAGAATCCTGGAGAAGGG + Intergenic
1050176441 9:2873882-2873904 TAGATAAGAATTCTGGAGGATGG + Intergenic
1050813742 9:9782110-9782132 CAAAGAATACTTCTGGAGAAAGG - Intronic
1056260317 9:84842048-84842070 GTCATCAAACTTCTGGAGAAAGG - Intronic
1056347632 9:85715274-85715296 CAAACAAGAATTCTGAAGAAGGG + Intronic
1057156658 9:92847758-92847780 CAGATCTGACTTCTGGATAAAGG + Exonic
1059927341 9:119223427-119223449 CACATAAGACTTCTGGAGAAAGG - Intronic
1060235493 9:121859836-121859858 CAAGGAAGACTTCAGGAGAAGGG - Intronic
1060316281 9:122514283-122514305 CACTGAAGACTACTAGAGAAAGG - Intergenic
1186540049 X:10391309-10391331 CACATATGATTTCGGGAGAGGGG - Intergenic
1192627211 X:72742552-72742574 CAAATCAAACTTCTGGAGATGGG - Intergenic
1192654497 X:72978261-72978283 CAAATCAAACTTCTGGAGATGGG + Intergenic
1193280676 X:79645394-79645416 CACTGGAGACTACTGGAGAAGGG - Intergenic
1194590262 X:95791706-95791728 TAAATAAGGCTTTTGGAGAAGGG + Intergenic
1195713276 X:107792744-107792766 CAGAGAAGGCTTCTGGAGAAGGG - Intronic
1199483311 X:148322340-148322362 CACATACAAATTTTGGAGAAGGG + Intergenic