ID: 1059930178

View in Genome Browser
Species Human (GRCh38)
Location 9:119252795-119252817
Sequence TCATTCTTCTGTACTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059930178_1059930181 4 Left 1059930178 9:119252795-119252817 CCAGTACCAGTACAGAAGAATGA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1059930181 9:119252822-119252844 ACCCCCACCACCAAATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059930178 Original CRISPR TCATTCTTCTGTACTGGTAC TGG (reversed) Intronic
903417477 1:23193806-23193828 TCATTGCTCTGGACAGGTACTGG - Exonic
905262613 1:36730271-36730293 ACATTCTCATGTACTGGTGCGGG + Intergenic
909286905 1:73830960-73830982 CCATCTTTCTGTTCTGGTACAGG + Intergenic
911268830 1:95775897-95775919 TCATTTTTCTTTACTGATCCAGG - Intergenic
911849762 1:102803288-102803310 TCATTCCTCAGTACTAGTAGGGG + Intergenic
911959447 1:104281924-104281946 ACATTCATCTGTGATGGTACAGG - Intergenic
916680568 1:167100981-167101003 TCATTCATCTGAACTGGTTTAGG - Intronic
917540170 1:175904385-175904407 TTATTCATCTGTACTGGAATTGG + Intergenic
918192765 1:182191990-182192012 TCATACTTCTGCACTAGTCCTGG + Intergenic
919573140 1:199273704-199273726 TCATTCCTCTTTACTCATACAGG - Intergenic
921476612 1:215617689-215617711 CCACTCTCCTGTCCTGGTACAGG - Intronic
921919530 1:220650872-220650894 CCATCCTTCTATCCTGGTACAGG - Intronic
1066242684 10:33553379-33553401 ACATGCTTCTGTAATGGTAATGG - Intergenic
1070452834 10:76579176-76579198 TCATTGTTCTGTGTTGGAACAGG - Intergenic
1071455435 10:85846954-85846976 TCATTCTTTTGTACTTGCATAGG - Intronic
1079654644 11:22973483-22973505 TCATTCTTCTGTAGTGCTGCTGG + Intergenic
1082711196 11:56555595-56555617 TCCTTCTTCTTTAATGGTATTGG + Intergenic
1087221964 11:95556218-95556240 TCATTCTTCTGAGATGGTTCTGG + Intergenic
1089442319 11:118527928-118527950 TCAGTCTTCTGTTCTGGTGGTGG - Intronic
1089918355 11:122181991-122182013 TCACTCTTTTGTACTGGTAAAGG - Intergenic
1094096793 12:26714331-26714353 TCATTTTCCTGTACTTGTATGGG + Intronic
1096953719 12:55503859-55503881 TAGTTCATCAGTACTGGTACTGG + Intergenic
1097283729 12:57862012-57862034 CCCTTCTTCTGTGCTGGTAAAGG + Intergenic
1097893529 12:64802007-64802029 TCATTTTTCTTTTCTGGTACTGG + Intronic
1098007554 12:66014495-66014517 TCATACATCTGTACCGGTATTGG + Intergenic
1104321014 12:127750812-127750834 TCAGTCTTCTGACCTTGTACAGG + Intergenic
1105486890 13:20842399-20842421 TCATTTTTTTATACTGGTAAAGG + Intronic
1109368168 13:61385108-61385130 TCATTCTTCTATACATGTATAGG + Intergenic
1110580963 13:77125037-77125059 TCTTTCTTCTGTACCAGTCCAGG - Intronic
1111372839 13:87338984-87339006 GCTATTTTCTGTACTGGTACAGG + Intergenic
1116092210 14:40323312-40323334 TCATGTTTCTGTACTTATACTGG - Intergenic
1116569092 14:46492197-46492219 ACATTCTTCTTTTCTGGTAATGG - Intergenic
1121862861 14:97336005-97336027 GCATCCTTCTGTCCTGGTCCTGG - Intergenic
1128035531 15:64521860-64521882 TCATTATTCTTTACTGGCCCTGG + Intronic
1129070132 15:72944048-72944070 TCTTTCTTCTGAATTGGAACTGG - Intergenic
1130409635 15:83634030-83634052 TCATTTTTCTCTCCTGATACAGG + Intergenic
1133626597 16:7575653-7575675 TCATTCTCCTGTAGTTGTAGAGG - Intronic
1134622017 16:15696630-15696652 TCGTTCTTCTGTACAGGCTCTGG + Intronic
1134910892 16:18025398-18025420 TCATGTTTCTTTGCTGGTACTGG - Intergenic
1144175077 17:12697311-12697333 TCATTCTTCTTTTCTGGTATAGG + Intronic
1150850265 17:68697461-68697483 TCATTTTTCTGTATGTGTACAGG + Intergenic
1152518742 17:80842652-80842674 GCATTGTTCTATACTTGTACTGG + Intronic
1155800914 18:30102385-30102407 TCATTCCACTGTGCTGGTGCTGG - Intergenic
1157384538 18:47250068-47250090 TCATTCCTGTGTACTGTTTCTGG - Intergenic
1157887569 18:51383623-51383645 TCAGACATCTGGACTGGTACTGG - Intergenic
1158093275 18:53740721-53740743 TCATTCTTCTAAACTTGAACTGG - Intergenic
1159244897 18:65793014-65793036 TCACTCTTCTTTAGTTGTACTGG + Intronic
929043004 2:37764009-37764031 TTATTTTTATGTACTGGTATTGG - Intergenic
930890148 2:56375143-56375165 ACATTCTTCTGTACAAGCACTGG - Intronic
938251475 2:129819092-129819114 TGATTTTTCTGTTCTGGTCCTGG - Intergenic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
942597993 2:177610331-177610353 TGTTTCTTTTGTACTGGTATAGG - Intergenic
942962539 2:181849438-181849460 GCATTGTTCTGTCCTGATACTGG + Intergenic
945860133 2:215111864-215111886 TCATTCTTCTGTGCATTTACAGG - Intronic
946190057 2:218003246-218003268 TCAGTCTTCTGATCTGGTGCTGG + Intergenic
947852249 2:233297757-233297779 TCATTCTTGTCTCCTGGTGCTGG - Intergenic
948443156 2:238010761-238010783 TCATTCTTGAGTACTGGGAGAGG - Intronic
1169356573 20:4911886-4911908 TCATGCTTCTGTACTCCAACTGG - Intronic
1175199826 20:57269115-57269137 TCCTTTTTCTCTACTGGCACTGG - Intergenic
1177786858 21:25680872-25680894 TCATCCTTCTGTTCTGATCCTGG - Intronic
1178104557 21:29303196-29303218 TAATTTTTCTGTATTAGTACAGG - Intronic
1179375658 21:40848011-40848033 TCATTCTTCTGTATTTGGAGGGG - Intergenic
949785501 3:7736059-7736081 TTTTTCTTTTGTAATGGTACAGG + Intronic
951001980 3:17573478-17573500 TCATTCTTCTTTCCTCTTACAGG + Intronic
955891622 3:63656135-63656157 TCATTCTTCTGTATTGAGACTGG + Intronic
958164402 3:89861151-89861173 TGTTTCTTCTCTCCTGGTACAGG + Intergenic
958470279 3:94508601-94508623 TCAGTCATCTGTACTAGTCCTGG - Intergenic
959550420 3:107649723-107649745 GCATTCTTCTTTACTTCTACCGG + Intronic
959639218 3:108612982-108613004 TGATTCTTTAGAACTGGTACAGG - Intronic
967666902 3:192183502-192183524 TCATTCTTCTTTGGTGGTGCAGG - Intronic
969909391 4:10429278-10429300 TCATTCTTCTCCACTGGAAATGG + Intergenic
971795780 4:31226319-31226341 GCATTGTTCTGTCTTGGTACAGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
977671905 4:99704717-99704739 TCATTCTTCTGTAAAGACACAGG + Intergenic
980383374 4:132056713-132056735 TCTTTTTTCTGTGCTGCTACAGG + Intergenic
980676037 4:136082578-136082600 TAATTTTTCTGTACTAATACAGG - Intergenic
981134931 4:141200008-141200030 TCAATCTTCTGTACTTCAACTGG - Intronic
988032016 5:25774646-25774668 TCACTCTTTTGTACTGATCCAGG - Intergenic
988105390 5:26740429-26740451 TCATTCTTGTGGACTGGTTGGGG - Intergenic
988144399 5:27287118-27287140 CAATTCTTCTGAACTGGCACAGG + Intergenic
990405104 5:55481690-55481712 ACATTCTTCTCTACTTGTTCAGG - Intronic
990405171 5:55482642-55482664 TCCTTTTCCTGTACTGGTTCAGG - Intronic
992656578 5:78916321-78916343 CCTTTCTTCTGGACTGGAACAGG - Intronic
993059204 5:83018517-83018539 TCATTCTTCTGTACAGAGGCCGG - Intergenic
993075477 5:83225349-83225371 TACTTTTTCTGTACTGGGACAGG + Intronic
993596550 5:89863801-89863823 TGTTTCTTCTCTTCTGGTACAGG - Intergenic
993835679 5:92817653-92817675 TCATTATTCTGAATTGGGACAGG - Intergenic
996839172 5:127827810-127827832 TCATTTTTCTGTCTAGGTACTGG - Intergenic
999792318 5:154952913-154952935 TCATTTTTATTTACTGCTACGGG - Intronic
1012410062 6:98947326-98947348 TCTTTCTTCAGGACTGCTACAGG - Intronic
1012693553 6:102349048-102349070 ACATTCTGCTGTACTTGTAAAGG - Intergenic
1015667356 6:135646992-135647014 TCATTCTTCATTTCTGTTACAGG - Intergenic
1016539836 6:145151967-145151989 TCTCTCTTCTGCACAGGTACTGG - Intergenic
1017563016 6:155652074-155652096 TCATTCTTTTTTACTGGTATTGG + Intergenic
1021993986 7:26162161-26162183 TCATTCTTCAGTTCTAGAACAGG + Intronic
1022665306 7:32405117-32405139 TCATTCTGTTGTACAGGTAGTGG + Intergenic
1028979890 7:96956085-96956107 TCATTCTTATTTATTGGTATTGG - Intergenic
1029573432 7:101386844-101386866 TCAATATTCTGTACTGGAAGGGG + Intronic
1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG + Intronic
1035586892 8:783343-783365 TCTTTCTTCTGTCTTGGTTCTGG + Intergenic
1044362293 8:91301164-91301186 TCATTTTTCTTTAGTGGTACTGG + Intronic
1045560446 8:103256741-103256763 TCATTCTCTTGTAGTGTTACAGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056236959 9:84604209-84604231 ACATTCTTCTATACTGCAACTGG - Intergenic
1056242774 9:84666054-84666076 TCTTTCTTCTTTCCTGATACAGG + Intergenic
1058057218 9:100460999-100461021 TCAGCCTGCTGTACAGGTACAGG - Intronic
1058422584 9:104846708-104846730 TCATTCATCTCTTCTGGAACGGG + Intronic
1059930178 9:119252795-119252817 TCATTCTTCTGTACTGGTACTGG - Intronic
1060836559 9:126759445-126759467 TCATTCTTATGTACTGCTGGTGG + Intergenic
1186083177 X:5955441-5955463 TAATTCTTTTCTACTGGTTCAGG - Intronic
1186294664 X:8135846-8135868 GCCTTCTTCTGTACTTCTACCGG - Intergenic
1187169776 X:16839745-16839767 ACATTTTTGTGTACTGGGACAGG + Intronic
1187203491 X:17158848-17158870 TCATTCTTCTGTGCTGCTGAAGG - Intergenic
1188384303 X:29537176-29537198 TCTTTATTCTGTACTCGCACAGG - Intronic
1191700921 X:64042146-64042168 TCATTTTTCTGTTCTGGTTTTGG - Intergenic
1193191652 X:78578514-78578536 TCTTTCTTCTGTTTTGGGACAGG + Intergenic
1197551283 X:127895773-127895795 TGAGTCTTCTGAATTGGTACTGG + Intergenic
1197745016 X:129926610-129926632 TCATTCTCCTGAACAAGTACCGG - Intronic
1198659805 X:138955920-138955942 TCTTTCTTGTGTATTGGTGCAGG - Intronic