ID: 1059932839

View in Genome Browser
Species Human (GRCh38)
Location 9:119278319-119278341
Sequence TTCACTGCTCAGAAAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059932839_1059932842 3 Left 1059932839 9:119278319-119278341 CCTTAATCTTTCTGAGCAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1059932842 9:119278345-119278367 TTCCCTACACAGTCAGAGGCAGG No data
1059932839_1059932847 27 Left 1059932839 9:119278319-119278341 CCTTAATCTTTCTGAGCAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1059932847 9:119278369-119278391 CCGCCTTGCTGACTGATTGTTGG No data
1059932839_1059932840 -1 Left 1059932839 9:119278319-119278341 CCTTAATCTTTCTGAGCAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1059932840 9:119278341-119278363 ACCATTCCCTACACAGTCAGAGG No data
1059932839_1059932843 4 Left 1059932839 9:119278319-119278341 CCTTAATCTTTCTGAGCAGTGAA 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1059932843 9:119278346-119278368 TCCCTACACAGTCAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059932839 Original CRISPR TTCACTGCTCAGAAAGATTA AGG (reversed) Intronic
900566989 1:3338417-3338439 TTCACTGCTCAGATAACTGAAGG - Intronic
901834249 1:11913570-11913592 TTCCCTGCCCAGAGAGATTCCGG + Intergenic
902908985 1:19581113-19581135 TTAAGCGCTCAGAAGGATTAAGG - Intergenic
905254436 1:36671084-36671106 TTCATGGCTCAGACAGATTTGGG - Intergenic
906654823 1:47540465-47540487 TTCCCAGCCCAGAAAGAATATGG - Intergenic
907815805 1:57917253-57917275 TACACTGCAGAGAAGGATTAAGG - Intronic
907942829 1:59105770-59105792 CTCACTGCTCAGAAATCTGAAGG - Intergenic
908799880 1:67868588-67868610 TTCATTGCTCTGAAAGAGGATGG - Intergenic
909364857 1:74807612-74807634 TTCAGTAGTCAGGAAGATTATGG - Intergenic
910298504 1:85678032-85678054 TTCACTGATGAGAAAAAATAAGG + Intronic
911809653 1:102259549-102259571 TTAACAGCTATGAAAGATTATGG - Intergenic
912124594 1:106519143-106519165 ATCACTGCTGAGAAAAATTAAGG + Intergenic
914224148 1:145706665-145706687 TGCACTGATCAGAATGATTCTGG + Intronic
914237486 1:145824884-145824906 TTCACTGCTTGGAAGAATTAAGG - Intronic
921331656 1:214044532-214044554 GGGACAGCTCAGAAAGATTAAGG + Intergenic
922313379 1:224417955-224417977 TTTACTGCACATAAAGATCATGG - Intronic
923936943 1:238772192-238772214 GTCACTGCAGAGAAATATTAAGG + Intergenic
924827591 1:247557127-247557149 TGCCCTTCTCTGAAAGATTATGG + Intronic
1064271450 10:13869973-13869995 TCCAGTGCTCAGTAGGATTAAGG - Intronic
1064865447 10:19873787-19873809 TCCACTGCAAAGTAAGATTAGGG + Intronic
1065299673 10:24309902-24309924 TGCACTGCTCATAAAGTTTAAGG - Intronic
1067694700 10:48526341-48526363 TTAACTCCTCAGAAAGACCAGGG + Intronic
1068059090 10:52044517-52044539 TTCATTGTTCTGAAAGTTTATGG + Intronic
1069219282 10:65863333-65863355 TTCACTACTCTGAAAGAATAAGG + Intergenic
1071837445 10:89432672-89432694 TTCCCTCCTCAGAAAGAAAATGG - Exonic
1072640520 10:97207734-97207756 ACCACGGCTCAGAAAGGTTAGGG - Intronic
1074450952 10:113559354-113559376 TTGGCTGCTCAGGAAGAATATGG - Intronic
1075322812 10:121505822-121505844 TACAGAGCTCAGAAAGATTCAGG + Intronic
1080578606 11:33623038-33623060 CTGACTGCTCACAAAGCTTATGG + Intronic
1082251836 11:49991150-49991172 GTCCCTGCTCAATAAGATTATGG + Intergenic
1083728411 11:64640440-64640462 CTCACTGCCCAGAAAGACCATGG + Intronic
1085082946 11:73648843-73648865 TTCTCTGCTCAGGAAGAGAATGG - Intronic
1085843411 11:80039473-80039495 TTCAGAGCTCAGAAAACTTACGG + Intergenic
1086978015 11:93159748-93159770 ATGACAGTTCAGAAAGATTAAGG + Intronic
1087571951 11:99939749-99939771 TTCACAGCACAGAATGATAAGGG - Intronic
1087980226 11:104603523-104603545 ATTACTGCTCAGAAAGAAAAAGG - Intergenic
1087989726 11:104733814-104733836 TTTACTGCTCAGTAACATTTGGG - Intergenic
1088981705 11:114870535-114870557 TTCACTTCCCAGCAATATTATGG + Intergenic
1089153398 11:116382680-116382702 TACACTGCTCAAAAACATTTAGG - Intergenic
1091931422 12:4398679-4398701 ATTAATGTTCAGAAAGATTATGG - Intergenic
1096826718 12:54284378-54284400 TGCACTGCTCAGCTACATTAGGG - Intronic
1097538165 12:60899984-60900006 AACACTGCTCAAAAAAATTATGG + Intergenic
1098149596 12:67532843-67532865 TTGACTGCTCAGCAGGATAATGG - Intergenic
1103217748 12:119215797-119215819 TTCAGTGCCCAGAGAGAGTAGGG - Intronic
1108152460 13:47550605-47550627 TTCAGATCTCAGAAAAATTAAGG - Intergenic
1108269059 13:48740840-48740862 TGCACTCCTAAGAGAGATTAAGG + Intergenic
1108851082 13:54730022-54730044 TTCACAGTTCAGCATGATTAGGG - Intergenic
1109935921 13:69284305-69284327 TTAACTCCTCAGAGAGAATATGG + Intergenic
1111256921 13:85682567-85682589 CTCAGTGCTCAGAAAGCTCAGGG - Intergenic
1111510772 13:89259524-89259546 TTCACTGATTAAAAATATTAAGG - Intergenic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1117980739 14:61340007-61340029 CTGAGTGCTCAGAAAGATTTGGG - Intronic
1120056195 14:79926875-79926897 TTTAGAGCTCAGAAAGAATAAGG - Intergenic
1120190797 14:81437426-81437448 TTCATTCCTTAGAAAGATTCAGG - Intergenic
1120465447 14:84850869-84850891 TTCACTGATTAGCAAGACTAAGG - Intergenic
1120858537 14:89234119-89234141 TAAACTGCTCTGAAAGACTAAGG + Intronic
1121032674 14:90672498-90672520 TTCACAGCTCCGCAAGCTTAAGG + Intronic
1121723476 14:96128977-96128999 TTTACTCCTCAGGAAGATGAAGG - Intergenic
1121900985 14:97693327-97693349 TTCATTGCTCTGCAAGATGAGGG + Intergenic
1125753378 15:42045554-42045576 CTCTGTGCTCAGAAAGATAACGG + Intronic
1126747407 15:51839838-51839860 TTCTCAGTTCAGAAAGAATAGGG + Intronic
1127312652 15:57766455-57766477 TTCACAGCCCAGAAAGACTTAGG - Intronic
1127552284 15:60052550-60052572 TTCACTACTCTGACAGAGTAAGG + Intronic
1128474987 15:67989547-67989569 ATCAAGGCTGAGAAAGATTAAGG + Intergenic
1129833318 15:78684686-78684708 TTCTCTGCTCAGAACACTTAAGG - Intronic
1130570240 15:85036296-85036318 TTCACTGCTCAGATATATGCTGG - Intronic
1130616252 15:85410797-85410819 TTCCGTTCTCAGAATGATTATGG + Intronic
1131903619 15:97116913-97116935 GTCACTGGTCAGAAAAATTCTGG + Intergenic
1133312345 16:4857384-4857406 TTCCTTGCTCACAAAGCTTAAGG + Intronic
1133791741 16:9014272-9014294 TTCTCTGCTCAGTAGGATTTTGG - Intergenic
1133802503 16:9095016-9095038 TTTCCTGCTCAGAAAACTTAAGG + Intronic
1135430717 16:22380448-22380470 TTCAACTCTCAGAAAGCTTATGG + Intronic
1136286626 16:29248005-29248027 TTCACAGCTGAGGAAGATGAGGG + Intergenic
1137784482 16:51126598-51126620 TTCACAGTTCAGAAAGACCATGG - Intergenic
1138364460 16:56462628-56462650 TTCACTGGTAAGGAAGATAAAGG + Exonic
1138760418 16:59537119-59537141 TTCATTACTCAGAAAGTTTCAGG - Intergenic
1140073428 16:71673755-71673777 TTCACTGTTTAGACACATTAAGG + Intronic
1141265265 16:82490862-82490884 TTTACTGAACAGAAAAATTATGG + Intergenic
1141342199 16:83213455-83213477 TTCTCTGCTCAGAAAAAGTTGGG - Intronic
1141414029 16:83856148-83856170 TTCACTGCTCAGGATGAATGGGG - Intergenic
1142092222 16:88220638-88220660 TTCACAGCTGAGGAAGATGAGGG + Intergenic
1144752828 17:17661740-17661762 TTCACGGCAAAGACAGATTAAGG + Intergenic
1146427977 17:32762075-32762097 TGCAGTGCTCAGGAAGGTTAGGG + Intronic
1146461906 17:33052752-33052774 TTCACTGCACAGATAAACTAGGG + Intronic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1149297731 17:55275664-55275686 ATCAAGGTTCAGAAAGATTAAGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150668173 17:67164857-67164879 TTCACTGCTCACAAATCTGATGG - Intronic
1153049633 18:889614-889636 TTCACTGCTATGAAAAATTCAGG - Intergenic
1154258516 18:12807858-12807880 TTTACTGCACAGAATGACTATGG + Intronic
1156416066 18:36891906-36891928 TACAGTCCTCAGAAAGATTAAGG - Intronic
1157798013 18:50593485-50593507 CTCTCTGCTCAGAAAGACTGCGG - Intronic
1158476152 18:57781471-57781493 TCCAGAGCTCAGAAAGATTAGGG + Intronic
1159325877 18:66916636-66916658 TTCACATCTCAGAATGATAAAGG - Intergenic
1159620589 18:70633693-70633715 TTCACTGGCCAGAAAAATGATGG - Intronic
1159725389 18:71951603-71951625 TCCACAGTTCAGAAAGGTTACGG + Intergenic
1159761469 18:72431374-72431396 GTCACTGCTCAGCAAGTTGATGG + Intergenic
1160091940 18:75835171-75835193 TTTAGTGCTCAGCAAGTTTATGG + Intergenic
1164962909 19:32451603-32451625 TTCACTTGTCAGAATGAGTATGG + Intronic
929801521 2:45108507-45108529 TTCAGTGGTCAGAAAGAGGAGGG + Intergenic
930428672 2:51245675-51245697 TTCACTTTTAATAAAGATTATGG - Intergenic
938241158 2:129743177-129743199 TTCACTGCTCTGCAAGAATGTGG - Intergenic
939202874 2:139061178-139061200 ATCCCTGCTTAGAAACATTATGG - Intergenic
939955209 2:148521997-148522019 TTCTCTGCTCAGAAAGCTGCGGG - Intergenic
944905051 2:204253758-204253780 TGCTTTGCTCAGAGAGATTATGG + Intergenic
945548334 2:211186830-211186852 TTCTCTTCACAGAAATATTATGG + Intergenic
1169719080 20:8652997-8653019 TTCAGTTCTCAGAAAGTTTGTGG - Intronic
1171421138 20:25018435-25018457 TCCACCTCTCAGAAAGAGTATGG - Intronic
1172481308 20:35273489-35273511 TTCACTGCTGAGAAAGCCAATGG + Intronic
1173638279 20:44580269-44580291 TTCACAGCTCAGAGAGATGTGGG - Intronic
1174205743 20:48837033-48837055 TTCACATTTCTGAAAGATTAAGG - Intergenic
1177356646 21:20017395-20017417 TTCACAGTTCAGAGAGAGTAAGG - Intergenic
1178189565 21:30264723-30264745 GTCACTGCTGAGAAAGTTTTGGG - Intergenic
1179624873 21:42643253-42643275 TCCACTGCTAAGAAAAATAAAGG + Intergenic
1181481074 22:23199475-23199497 TTCACTCCTCAGGAAGCTTGAGG + Intronic
949637989 3:6005106-6005128 TTTTCTGTTCAGAAAAATTAAGG - Intergenic
952807472 3:37370356-37370378 TTAACTGCTCACAAGAATTAAGG - Intergenic
953965043 3:47297983-47298005 TTCACTGGGCAGAAAAATGAGGG + Intronic
954160147 3:48715469-48715491 TCCACTGCTCAGACAGATACAGG + Intronic
956217120 3:66860167-66860189 TTCACTCTTCAGAAAGCTGATGG + Intergenic
957315770 3:78574797-78574819 TTCACTGATCACAAAGTTCATGG + Intergenic
958450112 3:94262353-94262375 ATCACTGCTCAGAAAGAAAAGGG - Intergenic
958926712 3:100166112-100166134 TTCACTGCTCTAAGAAATTATGG + Intronic
960493542 3:118348155-118348177 TTCACTGCTTTCATAGATTAAGG - Intergenic
963068898 3:141286445-141286467 TTCAGAGGTCAGAAAAATTAAGG + Intronic
964050997 3:152393401-152393423 TTCAATGCTCAGAAAGTAAAAGG - Intronic
964524208 3:157600281-157600303 TTCACTTATCTGAAAGAATATGG - Exonic
965133412 3:164730813-164730835 TTGGCTGCTCAGAAATATAAAGG - Intergenic
965595892 3:170410842-170410864 TTCACTGCTCTGTAATATGAAGG + Intergenic
967927376 3:194662158-194662180 CTCACTGTTCAGATGGATTACGG - Intronic
971478135 4:27091120-27091142 TTTACTGCTCATTACGATTAAGG + Intergenic
972920131 4:43929030-43929052 GTCACTGCTGAGAAATAGTATGG + Intergenic
972964493 4:44492811-44492833 GTCAATGCTCAGAAAGTTTCAGG - Intergenic
975903497 4:79181476-79181498 TTCACTCCTTAGAAAGTTCAAGG + Intergenic
976874984 4:89842209-89842231 TTCACTAATCTGAAATATTAGGG - Intergenic
977804461 4:101280387-101280409 ATTACTGCTCAGAAAGAACAAGG + Intronic
979411972 4:120390739-120390761 TTCAGTGGTCAGAATGATCAAGG + Intergenic
979437092 4:120706048-120706070 TAAACTGCTCAGAAAGATCTGGG + Intronic
981951617 4:150415977-150415999 TTTAATGCTTAGAAAGATTTTGG - Intronic
982054164 4:151530768-151530790 TTCTCTGCTCTGAAACATTCTGG + Intronic
984108453 4:175579166-175579188 TCCTCAGCTCTGAAAGATTATGG - Intergenic
984451769 4:179911920-179911942 AACACTGCAAAGAAAGATTAGGG - Intergenic
985219833 4:187692568-187692590 TACACAGCTAAGAAAGATCAGGG + Intergenic
986452136 5:7876898-7876920 CTCACAACTCAGAAATATTAAGG - Intronic
987137931 5:14917198-14917220 TTCTCTGCTGAGAAAGGTTGTGG + Intergenic
987729910 5:21756059-21756081 TTTTCTATTCAGAAAGATTATGG + Intronic
991227907 5:64293842-64293864 TTCACTTTTCAGAAAAAATACGG - Intronic
993166857 5:84367441-84367463 CTCATTGCTCAAAAATATTAAGG - Intronic
993803168 5:92370330-92370352 TTCAATGCTGCGAAAGACTATGG + Intergenic
994043339 5:95283604-95283626 TTGACTACTCAGAAAGCTTCTGG + Intronic
994476368 5:100275882-100275904 TTCACTACACACAAAGATCATGG + Intergenic
995037057 5:107546059-107546081 TTCACTGCCCAGAGAGATGGGGG + Intronic
996436942 5:123444614-123444636 TTCTCTGCTCAGAGAGAATATGG + Intergenic
996446813 5:123563605-123563627 TTCACTTCTGAGAAGTATTATGG + Intronic
999641813 5:153680125-153680147 TTCACTGCTCTGAAACCTCAAGG + Intronic
1001475500 5:172047766-172047788 TTCTCTCCTCAGAGAGTTTAGGG + Intronic
1003790069 6:9536227-9536249 CACACTGCACAGAAAGATGATGG - Intergenic
1005617736 6:27591492-27591514 GTCACTGCTCTTAAAGATTTTGG + Intergenic
1005799274 6:29403713-29403735 TTGAAAGCTCAGAAAGATAATGG - Intronic
1012162426 6:95902931-95902953 TTCAATGATCACAAAGCTTAAGG - Intergenic
1013200030 6:107885478-107885500 AACACTGCTGAGAAAAATTAGGG + Intronic
1014571988 6:123021031-123021053 TTCACTTATCTGAAAGAGTATGG + Intronic
1015058041 6:128928312-128928334 TTCACTGCTCTGGCAGAGTAAGG + Intronic
1017582069 6:155877014-155877036 TTTACTGTTCAGAAAGATGACGG + Intergenic
1018192214 6:161319581-161319603 TTCACTGCTCATAAAGTTAGGGG + Intergenic
1019167119 6:170104660-170104682 TTCAGTGCTAAAAGAGATTATGG + Intergenic
1020594615 7:10190379-10190401 TCCTCTGCTCAGAAAGCTGAAGG - Intergenic
1020843533 7:13253746-13253768 TTCACAGGATAGAAAGATTATGG - Intergenic
1021193901 7:17653058-17653080 TCCACTGCTCTGAAAGATTATGG - Intergenic
1022018143 7:26371234-26371256 TTCAGTGCTCCTAAAGATTTTGG + Intronic
1023006309 7:35872142-35872164 ATCCATGCTGAGAAAGATTAAGG + Intronic
1024394419 7:48849225-48849247 TTCACTGGACAGAAATATTGTGG - Intergenic
1024400844 7:48923416-48923438 TTCACTGGACAGAAATATTGTGG + Intergenic
1029961674 7:104694092-104694114 TTCCCTGTTCAGAAAGAGCAAGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1035492306 7:159291034-159291056 TTCCTTGCTCAGAGAGATGAGGG + Intergenic
1036194509 8:6702072-6702094 TCCTCTTCTCAGAAGGATTACGG + Intergenic
1037266128 8:17062144-17062166 TCCTCTGCCCAGGAAGATTATGG + Intronic
1038643488 8:29345653-29345675 TGGACTGCTCAGAAAAATGAGGG - Intronic
1039365844 8:36927138-36927160 GTCACTGCTTAGAAATACTAAGG + Intronic
1041875073 8:62678076-62678098 TTCACAGCTCCCAAAGATTATGG - Intronic
1043964350 8:86455630-86455652 AACATTGCTCAGAAAAATTAAGG + Intronic
1044906621 8:97010946-97010968 TTCTCTGCACAGAAAAATCATGG - Intronic
1045135887 8:99217891-99217913 TTCATGGCTCACAAAGATTTTGG + Intronic
1045449297 8:102305294-102305316 TTCTGTGCTCAGACAAATTAGGG + Exonic
1045683604 8:104688693-104688715 CACACTGCTCAGAAAGCATAGGG - Intronic
1045808384 8:106192188-106192210 TTAACTGCACTGAAAGACTAGGG + Intergenic
1045981151 8:108189477-108189499 TTCACTTTTCAGAATGAGTAAGG - Intergenic
1046095936 8:109560497-109560519 TTCTCTCCTCAGTAAGATGAGGG - Intronic
1047640545 8:126816140-126816162 TCTACTGCTCATAAATATTAAGG + Intergenic
1047752399 8:127891707-127891729 GGCTCTGCTCAGAAAGATCAGGG - Intergenic
1049149617 8:141026231-141026253 TTCACAGGGCAGAAGGATTAGGG + Intergenic
1050868916 9:10540684-10540706 TTCCCTGCTCAAAAAGAATGTGG + Intronic
1053311167 9:37021061-37021083 TTCATTGTTTAGAAAAATTACGG - Intronic
1053604886 9:39647717-39647739 TTAACTGCTCAGTAAGAAGATGG + Intergenic
1053862761 9:42404067-42404089 TTAACTGCTCAGTAAGAAGATGG + Intergenic
1054248656 9:62694698-62694720 TTAACTGCTCAGTAAGAAGATGG - Intergenic
1054562769 9:66729224-66729246 TTAACTGCTCAGTAAGAAGATGG - Intergenic
1055996637 9:82167381-82167403 TTCACTGCCCACGAAGATTCTGG - Intergenic
1056549256 9:87638138-87638160 TTCTCTGCTAAGAAAAATTGAGG + Intronic
1058149415 9:101447617-101447639 ATCACTGCAAAGAAATATTAGGG + Intergenic
1058364669 9:104194904-104194926 ATCCCTCCTCAGAAAGATTGAGG - Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1059598545 9:115749826-115749848 TTCAGTACTTGGAAAGATTAGGG + Intergenic
1059932839 9:119278319-119278341 TTCACTGCTCAGAAAGATTAAGG - Intronic
1060217523 9:121747176-121747198 CTGGCTGCTCAGAAAGTTTAGGG - Intronic
1186251088 X:7667411-7667433 TTCATAGCTCAGAAAGAATTAGG - Intergenic
1187608700 X:20916093-20916115 ATCACTGCTGAGTAAGATTGGGG + Intergenic
1188197517 X:27255683-27255705 TTTACTGCTCAGAAGGTTTTTGG + Intergenic
1192173080 X:68868676-68868698 TTCTCTGCTCATCCAGATTATGG - Intergenic
1194433727 X:93843963-93843985 TTCACTTATCAGAAATATAAGGG - Intergenic
1195804337 X:108746425-108746447 TTCAATTCAAAGAAAGATTATGG - Intergenic
1197171230 X:123436648-123436670 TTCACAGCCCAGAAAGCCTAAGG + Intronic
1197390801 X:125861371-125861393 GTCTCTGCTCAGGAAGGTTAGGG - Intergenic
1197823544 X:130565397-130565419 TTCACTAGTCAGATAGATTGGGG + Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1199405194 X:147449280-147449302 TTCAAAGCTCAGAAATATCAGGG - Intergenic
1202360751 Y:24107647-24107669 CTCACTGCTCAGAAATACAACGG + Intergenic
1202510027 Y:25562471-25562493 CTCACTGCTCAGAAATACAACGG - Intergenic