ID: 1059938750

View in Genome Browser
Species Human (GRCh38)
Location 9:119337361-119337383
Sequence CTAAAGATCTCATTCCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059938750_1059938755 10 Left 1059938750 9:119337361-119337383 CCACGTAGGAATGAGATCTTTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059938755 9:119337394-119337416 CACTTGTTTCAGGATAAGCCAGG No data
1059938750_1059938754 0 Left 1059938750 9:119337361-119337383 CCACGTAGGAATGAGATCTTTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059938754 9:119337384-119337406 GCTGCTGGGTCACTTGTTTCAGG No data
1059938750_1059938757 22 Left 1059938750 9:119337361-119337383 CCACGTAGGAATGAGATCTTTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059938757 9:119337406-119337428 GATAAGCCAGGAGGAAATACAGG No data
1059938750_1059938756 13 Left 1059938750 9:119337361-119337383 CCACGTAGGAATGAGATCTTTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059938750 Original CRISPR CTAAAGATCTCATTCCTACG TGG (reversed) Intronic
905064497 1:35168698-35168720 CTCATGATCTCATTCATATGTGG + Intergenic
912683669 1:111745158-111745180 GCAAAGATCTCATTGCTACTTGG + Intronic
917039477 1:170788537-170788559 ATAAATATCTCATTCCCATGTGG + Intergenic
919273466 1:195382112-195382134 CTAAAAATATCATTCATAAGAGG + Intergenic
919919143 1:202157992-202158014 CTGAAGTTCTCTTTCCTAAGGGG + Intronic
921870446 1:220133915-220133937 CTATAGAACTTATTCCTAGGTGG + Intronic
1063783902 10:9358138-9358160 TTAATGATCTCACTCATACGTGG - Intergenic
1064457955 10:15506268-15506290 CTAAAGATCTCCTTACTTAGGGG - Intergenic
1075665261 10:124225284-124225306 CTGATGATCTCATTCCTTTGGGG - Intergenic
1077914861 11:6604394-6604416 CTAGAGATCTCCTGGCTACGTGG + Intronic
1081778277 11:45692017-45692039 CACATGATCTCATTCCTATGTGG + Intergenic
1082198423 11:49331942-49331964 CTAAAGACCTCATTTCCAAGAGG + Intergenic
1086527222 11:87741799-87741821 CTAATGATCTCATTCTAACTAGG + Intergenic
1089934521 11:122350015-122350037 CTGAAGATCTGTTTCCTACTTGG + Intergenic
1090138998 11:124233897-124233919 CTAGAGCTCTCATTCCTAGCTGG - Intergenic
1091137631 11:133206355-133206377 CTAAATGTTTCATTGCTACGTGG - Intronic
1093655138 12:21686164-21686186 CTAAAGTACTCATTACTACTAGG + Intronic
1095599890 12:44002367-44002389 CAAAAGATCTCATCCCTAAAGGG - Intronic
1105683556 13:22753508-22753530 CTAAAGATATCATTCCAGCCAGG - Intergenic
1107518729 13:41158618-41158640 TAAAAGATCTCATCCCTATGGGG - Intergenic
1107919787 13:45193607-45193629 CTAAAGATGTCCTTCCTCTGGGG - Exonic
1110547129 13:76768009-76768031 CTTATGATATCATTCCTACTAGG + Intergenic
1113082431 13:106534018-106534040 CTAAGGATCCCATTCCTACCAGG + Intronic
1113143819 13:107184939-107184961 CTAATGACCTCATTCTTACTTGG - Intronic
1130860477 15:87881718-87881740 CTAAAGTTCTTATTTCTATGGGG + Intronic
1135781365 16:25304364-25304386 CTGAAGAACTAATTCCTATGGGG + Intergenic
1143930734 17:10420928-10420950 CTGAAGCTCTCATTCCTCTGTGG - Intronic
1149284641 17:55148871-55148893 CTAAAGATCTCATTAATTTGGGG + Intronic
1167804211 19:51768541-51768563 CTAAAGCTCCCACTCCTACCAGG - Intronic
941465946 2:165827408-165827430 CCAAAGAACTCATTGCTACAAGG + Intergenic
1184529795 22:45047822-45047844 CTCCAGATCTCATTCCTCGGGGG + Intergenic
949679509 3:6496424-6496446 TCAAAGATCTCATTCTTACTAGG + Intergenic
951082877 3:18472995-18473017 CTAATGATCACATTTCTACTGGG + Intergenic
957110656 3:75952255-75952277 CTAAAGAGCTCATTCTGACTTGG + Intronic
962889378 3:139657921-139657943 CTAAAGAGCTCCCTCCTACCAGG + Intronic
963402127 3:144812059-144812081 CTAGATTTCTCATTCCTTCGAGG + Intergenic
973760160 4:54108223-54108245 CTAAAGCTGCCATTCCTACTTGG + Intronic
974421892 4:61686873-61686895 CTCATGATCTCATTCATATGTGG - Intronic
978067638 4:104425169-104425191 CTAAATATATTATTCCCACGGGG + Intergenic
983519676 4:168694639-168694661 CTAAATATCTAATTCCTAATGGG - Intronic
990655209 5:57947429-57947451 CTAAAAATCTCCTCCCTAGGAGG - Intergenic
994585681 5:101706302-101706324 CTAAATATCTCATTCTTTTGTGG + Intergenic
996011899 5:118489886-118489908 CTAAAGGTCTGATCCCTACCTGG - Intergenic
998675205 5:144400274-144400296 GTAGAGATATCATACCTACGAGG - Intronic
999176052 5:149632415-149632437 ATAAAGAACTCATTCCGACCTGG + Exonic
1001908225 5:175491373-175491395 CTAAAGCTGTTATTCCTACTAGG - Intronic
1020620112 7:10506856-10506878 CTCATGTTCTCATTCCTAGGTGG + Intergenic
1020863430 7:13524132-13524154 CAAAAGTTCTCATTCCTAGAAGG + Intergenic
1021932630 7:25596772-25596794 CCAAAGATCTCCTTCCTGCTAGG + Intergenic
1024085599 7:45889283-45889305 CTAAAGATCTCTGGGCTACGAGG - Intronic
1030300876 7:107973529-107973551 CTAAAGATCTGATTTCCTCGTGG - Intronic
1056138233 9:83649531-83649553 CAAAAGACTTCATTCTTACGAGG - Intergenic
1057560183 9:96121827-96121849 CTCAAGATCTCACTCATATGTGG + Intergenic
1058526902 9:105868056-105868078 CCAATGATCTCATTCATATGTGG - Intergenic
1059738950 9:117130716-117130738 CAAAAGCTCCCATTCCTACATGG - Intronic
1059938750 9:119337361-119337383 CTAAAGATCTCATTCCTACGTGG - Intronic
1186243996 X:7600870-7600892 CTAAATCTCTCATTACTAAGGGG - Intergenic
1191970360 X:66807747-66807769 CTCATGATCTCATTTATACGTGG - Intergenic
1201463248 Y:14251808-14251830 CTAAATCTCTCATTACTATGGGG - Intergenic