ID: 1059938756

View in Genome Browser
Species Human (GRCh38)
Location 9:119337397-119337419
Sequence TTGTTTCAGGATAAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059938750_1059938756 13 Left 1059938750 9:119337361-119337383 CCACGTAGGAATGAGATCTTTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059938756 Original CRISPR TTGTTTCAGGATAAGCCAGG AGG Intronic
No off target data available for this crispr