ID: 1059942123

View in Genome Browser
Species Human (GRCh38)
Location 9:119368985-119369007
Sequence CCCCGAATGCGGCCCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059942114_1059942123 11 Left 1059942114 9:119368951-119368973 CCGGTAGGGGGAGGGGCAGAGGA 0: 1
1: 0
2: 1
3: 51
4: 518
Right 1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059942123 Original CRISPR CCCCGAATGCGGCCCGGGGC CGG Intronic
900003669 1:29722-29744 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
900023388 1:200238-200260 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
900116986 1:1033176-1033198 CCCCGACTCCCGCGCGGGGCGGG - Intronic
900118953 1:1040544-1040566 CCCCCGATGCGGCGCGGGGGCGG + Intronic
900123498 1:1059416-1059438 CCTCCACTGCGGACCGGGGCCGG - Intergenic
900183967 1:1324523-1324545 CTCCGTATGCGGCTCCGGGCGGG - Intronic
900351869 1:2238851-2238873 CCCAGAAGGCAGCCTGGGGCAGG - Intronic
900410304 1:2509677-2509699 CCCCGAAGGTGGCCTGGGGAGGG - Intronic
900417250 1:2540772-2540794 CCCCCCGTGCGCCCCGGGGCAGG + Intergenic
900435698 1:2629565-2629587 CCCCGAGCCCGGCCCGAGGCTGG + Intronic
900659548 1:3775743-3775765 CCCCTCATGCGGCCCTGGCCTGG + Intronic
901049781 1:6420295-6420317 CCCCTGCTGCGGCCCAGGGCGGG - Intronic
901396368 1:8985090-8985112 CCCAGAAAGCGGCCAGGGCCAGG - Intergenic
906152842 1:43598013-43598035 CCCCGAGAGCAGCCCGGTGCTGG + Exonic
912810964 1:112794171-112794193 CTCAGAAAGCTGCCCGGGGCGGG + Intergenic
920022637 1:202967248-202967270 CCCACAATGCGCCGCGGGGCGGG + Exonic
922419913 1:225452421-225452443 CCCAGAATGTGTCCTGGGGCTGG - Intergenic
1062939182 10:1409148-1409170 CCCCGCATCCAGCCCGGGGCAGG + Intronic
1065879576 10:30027338-30027360 ACGCGAAAGCGGCCCGGGGATGG + Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070811281 10:79299259-79299281 GCCCGAGTGGGGCCCTGGGCAGG + Intronic
1073207415 10:101776272-101776294 GCCTGGATGCAGCCCGGGGCGGG + Intronic
1076773162 10:132678194-132678216 CCCCGTATGCTGCCTGGGGGTGG + Intronic
1077008449 11:369720-369742 CCGGGGATGCGGCGCGGGGCGGG + Intergenic
1079136599 11:17779140-17779162 CCCTGCTTGGGGCCCGGGGCCGG + Intronic
1084428913 11:69100757-69100779 CCTCGAATGCTGCCCGAGCCTGG + Intergenic
1085457992 11:76676292-76676314 CCTCAAATGCTGACCGGGGCAGG - Intergenic
1090832327 11:130428184-130428206 CCCCGGCTGCGGGCCGGGCCGGG + Exonic
1091377087 12:31776-31798 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1097029429 12:56080554-56080576 CCCGGAATGCCGCCCTCGGCCGG - Intronic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122870288 14:104635287-104635309 CCCCGAAAGCCCCCGGGGGCCGG + Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1125899283 15:43330156-43330178 CCCAGACTGCAGCCCGGGCCAGG + Exonic
1129150340 15:73684368-73684390 GCCCGAATGGGGGCCGGGGGCGG - Exonic
1131184778 15:90265256-90265278 CCCTAGGTGCGGCCCGGGGCTGG + Intronic
1132449833 15:101961218-101961240 CCCGGGGTGCGCCCCGGGGCAGG - Intergenic
1132656689 16:1044472-1044494 CCCCCCAGGCGGCCCCGGGCGGG - Intergenic
1132785731 16:1656227-1656249 CCCCGAAAGCGCCCCCGGGGAGG + Exonic
1133033824 16:3023869-3023891 CCCCCAAGGCGGCCCGCGGGAGG + Exonic
1133039628 16:3053527-3053549 CACAGTATGCGGCCCAGGGCAGG - Intronic
1133043475 16:3073160-3073182 CACAGTATGCGGCCCAGGGCAGG - Intronic
1133784329 16:8963303-8963325 CCTCGCCTGCGGCCGGGGGCCGG + Exonic
1134806644 16:17131553-17131575 CCCCAAATGCCCTCCGGGGCAGG - Intronic
1136577010 16:31131015-31131037 CCCAGGATGGAGCCCGGGGCAGG + Exonic
1137057695 16:35753351-35753373 CCCCGAAAGCTACCCGGGTCGGG + Intergenic
1141615046 16:85205671-85205693 CACCGCATGCTGCCCAGGGCAGG - Intergenic
1143248460 17:5504781-5504803 CCCAGAATGCGGCCTGGGAAAGG - Intronic
1143452348 17:7043469-7043491 CCCCGGATGGGGGCTGGGGCTGG - Exonic
1144780830 17:17807637-17807659 CCCCACATGGGGCACGGGGCGGG - Intronic
1147583341 17:41638827-41638849 CCTCGGATGAGGCCCAGGGCGGG + Intergenic
1149685441 17:58532065-58532087 CCCCGAGTGCGGACCGCTGCGGG + Intronic
1151747023 17:76017246-76017268 CCCAGACTGCGGCCCGGTGTGGG + Intronic
1152304062 17:79511032-79511054 CCCTGAATGTTGCCTGGGGCTGG - Intronic
1152468543 17:80478328-80478350 CCCCTCCTGCGGCCCGGGGTCGG - Intergenic
1156448645 18:37254198-37254220 CCCCAAGTGGGGCCCGCGGCCGG + Intronic
1156517912 18:37696720-37696742 CCCCTGAAGCTGCCCGGGGCAGG - Intergenic
1160528222 18:79549395-79549417 GCCCGAGTGGGGCCCTGGGCTGG + Intergenic
1160635422 19:71329-71351 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1160788728 19:913118-913140 CCCCGAGTGCGGCCCGGAGGCGG - Exonic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1160979990 19:1812342-1812364 CCCGGAAGGGGGCCGGGGGCGGG + Intergenic
1161153534 19:2721285-2721307 CCAGGTAGGCGGCCCGGGGCGGG - Exonic
1161438795 19:4279273-4279295 CCCGGGACGCGGCCCGGGGCTGG + Exonic
1164958416 19:32406015-32406037 CCCCGACTGCGCCACGCGGCGGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165432644 19:35781309-35781331 CCCAGCATGCAGCACGGGGCTGG - Intronic
1166361282 19:42253943-42253965 GTCGGAATCCGGCCCGGGGCGGG - Intronic
1166391372 19:42410656-42410678 CCCAGCAGGCGGCCCAGGGCCGG + Exonic
1166931452 19:46303927-46303949 CCCGGGATGCGGCCCGCAGCCGG + Exonic
925751844 2:7096284-7096306 CCCAGAATGGGGCACAGGGCTGG + Intergenic
926022568 2:9510030-9510052 CCCCGAATGAGGACCAGGGAGGG - Exonic
936566060 2:113583718-113583740 CCCTGGGTGCGCCCCGGGGCAGG - Intergenic
943811645 2:192195272-192195294 CCGCGAGTGCGGGCCGCGGCTGG + Exonic
944715890 2:202376110-202376132 CCCCGAACGAGGGGCGGGGCCGG + Intergenic
947506608 2:230712860-230712882 CCCCGCTTGCGGCCCGAGCCCGG - Exonic
1176286114 21:5020482-5020504 CCCCCAGTGCCGCCCGGGGGCGG - Intergenic
1176299054 21:5090056-5090078 CCCAGAAGGCTGCCCTGGGCCGG + Intergenic
1176550273 21:8217868-8217890 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176569201 21:8400906-8400928 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176577115 21:8445138-8445160 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1179142064 21:38734375-38734397 CACCGAGTGCAGCCCTGGGCCGG + Intergenic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179857971 21:44171892-44171914 CCCAGAAGGCTGCCCTGGGCCGG - Intergenic
1179871067 21:44242993-44243015 CCCCCAGTGCCGCCCGGGGGCGG + Intergenic
1180699704 22:17774533-17774555 CCCCGCAAGCCGCCGGGGGCGGG - Intronic
1181531613 22:23520654-23520676 CCCCCACTGCGGCCCTGTGCTGG - Intergenic
1182874624 22:33680314-33680336 TCCAGAATGGGGCTCGGGGCGGG + Intronic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1183485150 22:38084461-38084483 CCTGGAATGTGGCCTGGGGCGGG - Intergenic
1183780260 22:39994897-39994919 CCCCGACGGCGGGGCGGGGCGGG + Intergenic
1184265200 22:43342861-43342883 CCCCGCGTGCGGACCTGGGCGGG - Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1185346718 22:50313618-50313640 CCCCTGGTGAGGCCCGGGGCTGG - Exonic
1185397433 22:50600332-50600354 ACCCGGGTGCGGCCCGGAGCGGG - Intronic
1203255168 22_KI270733v1_random:134206-134228 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203263224 22_KI270733v1_random:179285-179307 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
950428260 3:12936227-12936249 CCCTGGATGCGGCGCGGGCCCGG - Exonic
950441886 3:13015297-13015319 ACCCTAATGGGGCCTGGGGCTGG + Intronic
951611325 3:24495099-24495121 CCCGGGAAGCGGGCCGGGGCGGG - Intronic
968601034 4:1509440-1509462 CCACGGATGTGGCCCAGGGCCGG - Intergenic
968746945 4:2365135-2365157 CCCTGAATGCGGCGGGGGGACGG + Intronic
969138888 4:5051994-5052016 CACCGCATGCTGCCCGGCGCGGG + Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
981331406 4:143514032-143514054 CCCCGAAGGCGTCGCGGCGCAGG + Exonic
1002593107 5:180304626-180304648 CCCCACAGGCGGCCCGGGGGAGG + Intronic
1007432841 6:41786532-41786554 CCCCGACCGCGGCGCGGGGTGGG - Intronic
1015024625 6:128519440-128519462 CCCCGGATCCGGCCTGGGGCTGG - Intronic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1018856475 6:167678775-167678797 CCTGGAAAGCGGCCGGGGGCGGG - Intergenic
1018864545 6:167736639-167736661 CTCCAGATGCGGCCTGGGGCGGG + Intergenic
1019279570 7:193042-193064 CCCTGCACGCGGCCCGGGCCCGG + Exonic
1019290221 7:246650-246672 CCCCGAGTGCTGCCCTGAGCAGG + Intronic
1019290240 7:246735-246757 CCCCGAGTGCTGCCCTGAGCAGG + Intronic
1020127569 7:5541549-5541571 CCCTGAATGCGCCCCACGGCAGG - Intronic
1022723020 7:32957569-32957591 CCCCGATGGCGTTCCGGGGCTGG + Exonic
1023860173 7:44213728-44213750 CCCCCAATGTGGGCAGGGGCTGG + Exonic
1029444424 7:100604514-100604536 GCCCGATTGCGGACGGGGGCCGG - Intronic
1033288665 7:140062954-140062976 AACCGAAAGCGGCCCCGGGCCGG + Exonic
1035463825 7:159063093-159063115 CTCCGCCTGCGGCCCGGTGCAGG - Intronic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1048254266 8:132893856-132893878 CCGCGAAAGCCTCCCGGGGCGGG - Exonic
1049784505 8:144444117-144444139 CCCCGATCCCGGCCCGGGCCCGG + Intronic
1049886365 9:29500-29522 CCCGGGGTGCGCCCCGGGGCAGG + Intergenic
1054460554 9:65460002-65460024 CTCTGACTGCGTCCCGGGGCTGG + Intergenic
1054731465 9:68705741-68705763 ACCCGAATGCTGCCCGGGTGAGG + Exonic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1061248893 9:129415130-129415152 CCCCCACTGCGGCCCTGTGCTGG + Intergenic
1203471566 Un_GL000220v1:117343-117365 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203479387 Un_GL000220v1:161315-161337 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1190346415 X:49341562-49341584 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190347666 X:49532591-49532613 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190348767 X:49542147-49542169 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190349867 X:49551703-49551725 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190350972 X:49561256-49561278 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190352073 X:49570814-49570836 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190353174 X:49580363-49580385 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190354275 X:49589910-49589932 CCCTGAATGGGGCCCCCGGCGGG + Intronic
1190355377 X:49599434-49599456 CCCTGAATGGGGCCCCCGGCGGG + Intronic