ID: 1059943465

View in Genome Browser
Species Human (GRCh38)
Location 9:119381137-119381159
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059943465_1059943470 11 Left 1059943465 9:119381137-119381159 CCCTAGTTGGGTGACCCTCAGCA No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059943465 Original CRISPR TGCTGAGGGTCACCCAACTA GGG (reversed) Intergenic
No off target data available for this crispr