ID: 1059943466

View in Genome Browser
Species Human (GRCh38)
Location 9:119381138-119381160
Sequence TTGCTGAGGGTCACCCAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059943466_1059943470 10 Left 1059943466 9:119381138-119381160 CCTAGTTGGGTGACCCTCAGCAA No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059943466 Original CRISPR TTGCTGAGGGTCACCCAACT AGG (reversed) Intergenic
No off target data available for this crispr