ID: 1059943467

View in Genome Browser
Species Human (GRCh38)
Location 9:119381151-119381173
Sequence CTGGTTTAAGATGTTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059943467_1059943471 28 Left 1059943467 9:119381151-119381173 CCCTCAGCAACATCTTAAACCAG No data
Right 1059943471 9:119381202-119381224 TTTTTCTTACATCTTTTTCAAGG No data
1059943467_1059943470 -3 Left 1059943467 9:119381151-119381173 CCCTCAGCAACATCTTAAACCAG No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059943467 Original CRISPR CTGGTTTAAGATGTTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr