ID: 1059943468

View in Genome Browser
Species Human (GRCh38)
Location 9:119381152-119381174
Sequence ACTGGTTTAAGATGTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059943468_1059943471 27 Left 1059943468 9:119381152-119381174 CCTCAGCAACATCTTAAACCAGT No data
Right 1059943471 9:119381202-119381224 TTTTTCTTACATCTTTTTCAAGG No data
1059943468_1059943470 -4 Left 1059943468 9:119381152-119381174 CCTCAGCAACATCTTAAACCAGT No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059943468 Original CRISPR ACTGGTTTAAGATGTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr