ID: 1059943470

View in Genome Browser
Species Human (GRCh38)
Location 9:119381171-119381193
Sequence CAGTATCTTCATCTTCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059943465_1059943470 11 Left 1059943465 9:119381137-119381159 CCCTAGTTGGGTGACCCTCAGCA No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data
1059943464_1059943470 17 Left 1059943464 9:119381131-119381153 CCTTCACCCTAGTTGGGTGACCC No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data
1059943466_1059943470 10 Left 1059943466 9:119381138-119381160 CCTAGTTGGGTGACCCTCAGCAA No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data
1059943467_1059943470 -3 Left 1059943467 9:119381151-119381173 CCCTCAGCAACATCTTAAACCAG No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data
1059943468_1059943470 -4 Left 1059943468 9:119381152-119381174 CCTCAGCAACATCTTAAACCAGT No data
Right 1059943470 9:119381171-119381193 CAGTATCTTCATCTTCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059943470 Original CRISPR CAGTATCTTCATCTTCAACA TGG Intergenic
No off target data available for this crispr