ID: 1059946769

View in Genome Browser
Species Human (GRCh38)
Location 9:119417169-119417191
Sequence CTGTAGACAAGGAGATTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059946764_1059946769 14 Left 1059946764 9:119417132-119417154 CCTAAAACAAGCTATGTATCTGG No data
Right 1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG No data
1059946763_1059946769 21 Left 1059946763 9:119417125-119417147 CCTTTTGCCTAAAACAAGCTATG No data
Right 1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059946769 Original CRISPR CTGTAGACAAGGAGATTATC TGG Intergenic
No off target data available for this crispr