ID: 1059947122

View in Genome Browser
Species Human (GRCh38)
Location 9:119420823-119420845
Sequence TAATTGATGCAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059947119_1059947122 22 Left 1059947119 9:119420778-119420800 CCATAGTTTTGCAGCAAATGGAA No data
Right 1059947122 9:119420823-119420845 TAATTGATGCAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059947122 Original CRISPR TAATTGATGCAGAGGAAGGA AGG Intergenic
No off target data available for this crispr