ID: 1059947861

View in Genome Browser
Species Human (GRCh38)
Location 9:119430394-119430416
Sequence TCAACTCAAGGGCTTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059947856_1059947861 22 Left 1059947856 9:119430349-119430371 CCATTCCTGTTTTTATTATCTGT No data
Right 1059947861 9:119430394-119430416 TCAACTCAAGGGCTTGCTCAAGG No data
1059947855_1059947861 28 Left 1059947855 9:119430343-119430365 CCATATCCATTCCTGTTTTTATT No data
Right 1059947861 9:119430394-119430416 TCAACTCAAGGGCTTGCTCAAGG No data
1059947857_1059947861 17 Left 1059947857 9:119430354-119430376 CCTGTTTTTATTATCTGTGCCAT No data
Right 1059947861 9:119430394-119430416 TCAACTCAAGGGCTTGCTCAAGG No data
1059947858_1059947861 -2 Left 1059947858 9:119430373-119430395 CCATCTCTGATTTAAATCATTTC No data
Right 1059947861 9:119430394-119430416 TCAACTCAAGGGCTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059947861 Original CRISPR TCAACTCAAGGGCTTGCTCA AGG Intergenic