ID: 1059949812

View in Genome Browser
Species Human (GRCh38)
Location 9:119450583-119450605
Sequence AAGGCGCCAGATCCATGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949812_1059949818 23 Left 1059949812 9:119450583-119450605 CCTATCCATGGATCTGGCGCCTT No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data
1059949812_1059949817 22 Left 1059949812 9:119450583-119450605 CCTATCCATGGATCTGGCGCCTT No data
Right 1059949817 9:119450628-119450650 GTGTACATCTTTAGGTATGAAGG No data
1059949812_1059949816 14 Left 1059949812 9:119450583-119450605 CCTATCCATGGATCTGGCGCCTT No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949812 Original CRISPR AAGGCGCCAGATCCATGGAT AGG (reversed) Intergenic
No off target data available for this crispr