ID: 1059949813

View in Genome Browser
Species Human (GRCh38)
Location 9:119450588-119450610
Sequence TTCTCAAGGCGCCAGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949813_1059949817 17 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949817 9:119450628-119450650 GTGTACATCTTTAGGTATGAAGG No data
1059949813_1059949820 29 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949820 9:119450640-119450662 AGGTATGAAGGGTGCCTGAAGGG No data
1059949813_1059949818 18 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data
1059949813_1059949819 28 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949819 9:119450639-119450661 TAGGTATGAAGGGTGCCTGAAGG No data
1059949813_1059949816 9 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949813 Original CRISPR TTCTCAAGGCGCCAGATCCA TGG (reversed) Intergenic
No off target data available for this crispr