ID: 1059949815

View in Genome Browser
Species Human (GRCh38)
Location 9:119450602-119450624
Sequence AACAGCTGAGTCCATTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949815_1059949818 4 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data
1059949815_1059949819 14 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949819 9:119450639-119450661 TAGGTATGAAGGGTGCCTGAAGG No data
1059949815_1059949822 29 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949822 9:119450654-119450676 CCTGAAGGGTATGTCTTAGATGG No data
1059949815_1059949816 -5 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data
1059949815_1059949817 3 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949817 9:119450628-119450650 GTGTACATCTTTAGGTATGAAGG No data
1059949815_1059949820 15 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949820 9:119450640-119450662 AGGTATGAAGGGTGCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949815 Original CRISPR AACAGCTGAGTCCATTCTCA AGG (reversed) Intergenic
No off target data available for this crispr