ID: 1059949816

View in Genome Browser
Species Human (GRCh38)
Location 9:119450620-119450642
Sequence CTGTTGATGTGTACATCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949815_1059949816 -5 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data
1059949809_1059949816 27 Left 1059949809 9:119450570-119450592 CCACTTGCAGGGTCCTATCCATG No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data
1059949813_1059949816 9 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data
1059949812_1059949816 14 Left 1059949812 9:119450583-119450605 CCTATCCATGGATCTGGCGCCTT No data
Right 1059949816 9:119450620-119450642 CTGTTGATGTGTACATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949816 Original CRISPR CTGTTGATGTGTACATCTTT AGG Intergenic
No off target data available for this crispr