ID: 1059949818

View in Genome Browser
Species Human (GRCh38)
Location 9:119450629-119450651
Sequence TGTACATCTTTAGGTATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949813_1059949818 18 Left 1059949813 9:119450588-119450610 CCATGGATCTGGCGCCTTGAGAA No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data
1059949815_1059949818 4 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data
1059949812_1059949818 23 Left 1059949812 9:119450583-119450605 CCTATCCATGGATCTGGCGCCTT No data
Right 1059949818 9:119450629-119450651 TGTACATCTTTAGGTATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949818 Original CRISPR TGTACATCTTTAGGTATGAA GGG Intergenic
No off target data available for this crispr