ID: 1059949822

View in Genome Browser
Species Human (GRCh38)
Location 9:119450654-119450676
Sequence CCTGAAGGGTATGTCTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059949815_1059949822 29 Left 1059949815 9:119450602-119450624 CCTTGAGAATGGACTCAGCTGTT No data
Right 1059949822 9:119450654-119450676 CCTGAAGGGTATGTCTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059949822 Original CRISPR CCTGAAGGGTATGTCTTAGA TGG Intergenic
No off target data available for this crispr