ID: 1059959296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:119549823-119549845 |
| Sequence | CTTACCAGCATGGGAAGGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1059959296_1059959302 | 1 | Left | 1059959296 | 9:119549823-119549845 | CCACCCCTTCCCATGCTGGTAAG | No data | ||
| Right | 1059959302 | 9:119549847-119549869 | AGCTTATTTAGCCCAGCGTGTGG | No data | ||||
| 1059959296_1059959306 | 28 | Left | 1059959296 | 9:119549823-119549845 | CCACCCCTTCCCATGCTGGTAAG | No data | ||
| Right | 1059959306 | 9:119549874-119549896 | CTTATGAACCCAGAGAAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1059959296 | Original CRISPR | CTTACCAGCATGGGAAGGGG TGG (reversed) | Intergenic | ||