ID: 1059959296

View in Genome Browser
Species Human (GRCh38)
Location 9:119549823-119549845
Sequence CTTACCAGCATGGGAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959296_1059959306 28 Left 1059959296 9:119549823-119549845 CCACCCCTTCCCATGCTGGTAAG No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959296_1059959302 1 Left 1059959296 9:119549823-119549845 CCACCCCTTCCCATGCTGGTAAG No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959296 Original CRISPR CTTACCAGCATGGGAAGGGG TGG (reversed) Intergenic