ID: 1059959301

View in Genome Browser
Species Human (GRCh38)
Location 9:119549833-119549855
Sequence AAATAAGCTGCTTACCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959301_1059959306 18 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959301_1059959309 28 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959301_1059959310 29 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959301_1059959302 -9 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959301 Original CRISPR AAATAAGCTGCTTACCAGCA TGG (reversed) Intergenic
No off target data available for this crispr