ID: 1059959302

View in Genome Browser
Species Human (GRCh38)
Location 9:119549847-119549869
Sequence AGCTTATTTAGCCCAGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959297_1059959302 -2 Left 1059959297 9:119549826-119549848 CCCCTTCCCATGCTGGTAAGCAG No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data
1059959296_1059959302 1 Left 1059959296 9:119549823-119549845 CCACCCCTTCCCATGCTGGTAAG No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data
1059959300_1059959302 -8 Left 1059959300 9:119549832-119549854 CCCATGCTGGTAAGCAGCTTATT No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data
1059959301_1059959302 -9 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data
1059959299_1059959302 -4 Left 1059959299 9:119549828-119549850 CCTTCCCATGCTGGTAAGCAGCT No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data
1059959298_1059959302 -3 Left 1059959298 9:119549827-119549849 CCCTTCCCATGCTGGTAAGCAGC No data
Right 1059959302 9:119549847-119549869 AGCTTATTTAGCCCAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959302 Original CRISPR AGCTTATTTAGCCCAGCGTG TGG Intergenic