ID: 1059959303

View in Genome Browser
Species Human (GRCh38)
Location 9:119549858-119549880
Sequence TCATAAGATGGCCACACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959303_1059959312 25 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959312 9:119549906-119549928 GGAATTATCTCTAGGAGTGCTGG No data
1059959303_1059959314 27 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959314 9:119549908-119549930 AATTATCTCTAGGAGTGCTGGGG No data
1059959303_1059959310 4 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959303_1059959313 26 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959303_1059959315 28 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959315 9:119549909-119549931 ATTATCTCTAGGAGTGCTGGGGG No data
1059959303_1059959311 17 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959311 9:119549898-119549920 TGCTGCTGGGAATTATCTCTAGG No data
1059959303_1059959306 -7 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959303_1059959309 3 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959303 Original CRISPR TCATAAGATGGCCACACGCT GGG (reversed) Intergenic
No off target data available for this crispr