ID: 1059959305

View in Genome Browser
Species Human (GRCh38)
Location 9:119549870-119549892
Sequence TCTTCTCTGGGTTCATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959305_1059959310 -8 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959305_1059959313 14 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959305_1059959311 5 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959311 9:119549898-119549920 TGCTGCTGGGAATTATCTCTAGG No data
1059959305_1059959314 15 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959314 9:119549908-119549930 AATTATCTCTAGGAGTGCTGGGG No data
1059959305_1059959309 -9 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959305_1059959312 13 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959312 9:119549906-119549928 GGAATTATCTCTAGGAGTGCTGG No data
1059959305_1059959315 16 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959315 9:119549909-119549931 ATTATCTCTAGGAGTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959305 Original CRISPR TCTTCTCTGGGTTCATAAGA TGG (reversed) Intergenic