ID: 1059959306

View in Genome Browser
Species Human (GRCh38)
Location 9:119549874-119549896
Sequence CTTATGAACCCAGAGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959304_1059959306 -8 Left 1059959304 9:119549859-119549881 CCAGCGTGTGGCCATCTTATGAA No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959299_1059959306 23 Left 1059959299 9:119549828-119549850 CCTTCCCATGCTGGTAAGCAGCT No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959301_1059959306 18 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959297_1059959306 25 Left 1059959297 9:119549826-119549848 CCCCTTCCCATGCTGGTAAGCAG No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959303_1059959306 -7 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959298_1059959306 24 Left 1059959298 9:119549827-119549849 CCCTTCCCATGCTGGTAAGCAGC No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959296_1059959306 28 Left 1059959296 9:119549823-119549845 CCACCCCTTCCCATGCTGGTAAG No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data
1059959300_1059959306 19 Left 1059959300 9:119549832-119549854 CCCATGCTGGTAAGCAGCTTATT No data
Right 1059959306 9:119549874-119549896 CTTATGAACCCAGAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959306 Original CRISPR CTTATGAACCCAGAGAAGAG AGG Intergenic