ID: 1059959308

View in Genome Browser
Species Human (GRCh38)
Location 9:119549883-119549905
Sequence CAGCAGCAGCCTCTCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959308_1059959312 0 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959312 9:119549906-119549928 GGAATTATCTCTAGGAGTGCTGG No data
1059959308_1059959314 2 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959314 9:119549908-119549930 AATTATCTCTAGGAGTGCTGGGG No data
1059959308_1059959313 1 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959308_1059959316 28 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959316 9:119549934-119549956 AGCGAGTCACTGTGATGATGAGG No data
1059959308_1059959311 -8 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959311 9:119549898-119549920 TGCTGCTGGGAATTATCTCTAGG No data
1059959308_1059959315 3 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959315 9:119549909-119549931 ATTATCTCTAGGAGTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959308 Original CRISPR CAGCAGCAGCCTCTCTTCTC TGG (reversed) Intergenic
No off target data available for this crispr