ID: 1059959309

View in Genome Browser
Species Human (GRCh38)
Location 9:119549884-119549906
Sequence CAGAGAAGAGAGGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959300_1059959309 29 Left 1059959300 9:119549832-119549854 CCCATGCTGGTAAGCAGCTTATT No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959304_1059959309 2 Left 1059959304 9:119549859-119549881 CCAGCGTGTGGCCATCTTATGAA No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959305_1059959309 -9 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959303_1059959309 3 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data
1059959301_1059959309 28 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959309 Original CRISPR CAGAGAAGAGAGGCTGCTGC TGG Intergenic