ID: 1059959310

View in Genome Browser
Species Human (GRCh38)
Location 9:119549885-119549907
Sequence AGAGAAGAGAGGCTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959301_1059959310 29 Left 1059959301 9:119549833-119549855 CCATGCTGGTAAGCAGCTTATTT No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959300_1059959310 30 Left 1059959300 9:119549832-119549854 CCCATGCTGGTAAGCAGCTTATT No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959303_1059959310 4 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959304_1059959310 3 Left 1059959304 9:119549859-119549881 CCAGCGTGTGGCCATCTTATGAA No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data
1059959305_1059959310 -8 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959310 9:119549885-119549907 AGAGAAGAGAGGCTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959310 Original CRISPR AGAGAAGAGAGGCTGCTGCT GGG Intergenic
No off target data available for this crispr