ID: 1059959313

View in Genome Browser
Species Human (GRCh38)
Location 9:119549907-119549929
Sequence GAATTATCTCTAGGAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959303_1059959313 26 Left 1059959303 9:119549858-119549880 CCCAGCGTGTGGCCATCTTATGA No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959308_1059959313 1 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959304_1059959313 25 Left 1059959304 9:119549859-119549881 CCAGCGTGTGGCCATCTTATGAA No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959307_1059959313 2 Left 1059959307 9:119549882-119549904 CCCAGAGAAGAGAGGCTGCTGCT No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data
1059959305_1059959313 14 Left 1059959305 9:119549870-119549892 CCATCTTATGAACCCAGAGAAGA No data
Right 1059959313 9:119549907-119549929 GAATTATCTCTAGGAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959313 Original CRISPR GAATTATCTCTAGGAGTGCT GGG Intergenic
No off target data available for this crispr