ID: 1059959316

View in Genome Browser
Species Human (GRCh38)
Location 9:119549934-119549956
Sequence AGCGAGTCACTGTGATGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059959308_1059959316 28 Left 1059959308 9:119549883-119549905 CCAGAGAAGAGAGGCTGCTGCTG No data
Right 1059959316 9:119549934-119549956 AGCGAGTCACTGTGATGATGAGG No data
1059959307_1059959316 29 Left 1059959307 9:119549882-119549904 CCCAGAGAAGAGAGGCTGCTGCT No data
Right 1059959316 9:119549934-119549956 AGCGAGTCACTGTGATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059959316 Original CRISPR AGCGAGTCACTGTGATGATG AGG Intergenic