ID: 1059967290

View in Genome Browser
Species Human (GRCh38)
Location 9:119627725-119627747
Sequence GGCCATGTGCACAGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059967290_1059967300 20 Left 1059967290 9:119627725-119627747 CCCCTAGGACTGTGCACATGGCC No data
Right 1059967300 9:119627768-119627790 TGATTTTCTTCCTACCTCCCAGG No data
1059967290_1059967301 21 Left 1059967290 9:119627725-119627747 CCCCTAGGACTGTGCACATGGCC No data
Right 1059967301 9:119627769-119627791 GATTTTCTTCCTACCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059967290 Original CRISPR GGCCATGTGCACAGTCCTAG GGG (reversed) Intergenic
No off target data available for this crispr