ID: 1059968209

View in Genome Browser
Species Human (GRCh38)
Location 9:119637227-119637249
Sequence TTGAATATATAAATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059968209_1059968220 15 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968220 9:119637265-119637287 GGGGCAGGGTGAGGCTGCAGGGG No data
1059968209_1059968212 -6 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968212 9:119637244-119637266 ATTCAATATCTCAGGCAGCATGG No data
1059968209_1059968214 -4 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968214 9:119637246-119637268 TCAATATCTCAGGCAGCATGGGG No data
1059968209_1059968216 1 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968216 9:119637251-119637273 ATCTCAGGCAGCATGGGGCAGGG No data
1059968209_1059968215 0 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968215 9:119637250-119637272 TATCTCAGGCAGCATGGGGCAGG No data
1059968209_1059968219 14 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968219 9:119637264-119637286 TGGGGCAGGGTGAGGCTGCAGGG No data
1059968209_1059968217 6 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968217 9:119637256-119637278 AGGCAGCATGGGGCAGGGTGAGG No data
1059968209_1059968218 13 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968218 9:119637263-119637285 ATGGGGCAGGGTGAGGCTGCAGG No data
1059968209_1059968213 -5 Left 1059968209 9:119637227-119637249 CCATTTTCCATTTATATATTCAA No data
Right 1059968213 9:119637245-119637267 TTCAATATCTCAGGCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059968209 Original CRISPR TTGAATATATAAATGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr