ID: 1059968511

View in Genome Browser
Species Human (GRCh38)
Location 9:119640165-119640187
Sequence CTGTCCGAATAAATGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059968509_1059968511 1 Left 1059968509 9:119640141-119640163 CCAAAAGATGGAAGAGAAGAGAG No data
Right 1059968511 9:119640165-119640187 CTGTCCGAATAAATGTGTGCTGG No data
1059968508_1059968511 2 Left 1059968508 9:119640140-119640162 CCCAAAAGATGGAAGAGAAGAGA No data
Right 1059968511 9:119640165-119640187 CTGTCCGAATAAATGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059968511 Original CRISPR CTGTCCGAATAAATGTGTGC TGG Intergenic
No off target data available for this crispr