ID: 1059969063

View in Genome Browser
Species Human (GRCh38)
Location 9:119645885-119645907
Sequence TGTCACTTGCTGATAGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969063_1059969064 16 Left 1059969063 9:119645885-119645907 CCTAACACTATCAGCAAGTGACA No data
Right 1059969064 9:119645924-119645946 CACATTTCCTTGAAAGAAAATGG No data
1059969063_1059969065 17 Left 1059969063 9:119645885-119645907 CCTAACACTATCAGCAAGTGACA No data
Right 1059969065 9:119645925-119645947 ACATTTCCTTGAAAGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969063 Original CRISPR TGTCACTTGCTGATAGTGTT AGG (reversed) Intergenic
No off target data available for this crispr