ID: 1059969692

View in Genome Browser
Species Human (GRCh38)
Location 9:119652787-119652809
Sequence TCACTAGGGATTGTGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969692_1059969700 10 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG No data
1059969692_1059969699 9 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969699 9:119652819-119652841 AAACTGCATGGACCAGTCTGAGG No data
1059969692_1059969703 23 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969703 9:119652833-119652855 AGTCTGAGGGGAGCTTAATCAGG No data
1059969692_1059969697 -3 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969692_1059969701 11 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969701 9:119652821-119652843 ACTGCATGGACCAGTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969692 Original CRISPR TCACTAGGGATTGTGGGATG TGG (reversed) Intergenic
No off target data available for this crispr