ID: 1059969695

View in Genome Browser
Species Human (GRCh38)
Location 9:119652801-119652823
Sequence AGTTTTTGGCTGATTCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969695_1059969699 -5 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969699 9:119652819-119652841 AAACTGCATGGACCAGTCTGAGG No data
1059969695_1059969703 9 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969703 9:119652833-119652855 AGTCTGAGGGGAGCTTAATCAGG No data
1059969695_1059969700 -4 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG No data
1059969695_1059969701 -3 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969701 9:119652821-119652843 ACTGCATGGACCAGTCTGAGGGG No data
1059969695_1059969704 19 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969695 Original CRISPR AGTTTTTGGCTGATTCACTA GGG (reversed) Intergenic
No off target data available for this crispr