ID: 1059969696

View in Genome Browser
Species Human (GRCh38)
Location 9:119652802-119652824
Sequence CAGTTTTTGGCTGATTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969696_1059969699 -6 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969699 9:119652819-119652841 AAACTGCATGGACCAGTCTGAGG No data
1059969696_1059969704 18 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data
1059969696_1059969703 8 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969703 9:119652833-119652855 AGTCTGAGGGGAGCTTAATCAGG No data
1059969696_1059969701 -4 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969701 9:119652821-119652843 ACTGCATGGACCAGTCTGAGGGG No data
1059969696_1059969700 -5 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969696 Original CRISPR CAGTTTTTGGCTGATTCACT AGG (reversed) Intergenic
No off target data available for this crispr