ID: 1059969697

View in Genome Browser
Species Human (GRCh38)
Location 9:119652807-119652829
Sequence TGAATCAGCCAAAAACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969694_1059969697 -10 Left 1059969694 9:119652794-119652816 CCACAATCCCTAGTGAATCAGCC No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969692_1059969697 -3 Left 1059969692 9:119652787-119652809 CCACATCCCACAATCCCTAGTGA No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969690_1059969697 24 Left 1059969690 9:119652760-119652782 CCCTGGCTTGCTTTCTAATCTCT No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969689_1059969697 28 Left 1059969689 9:119652756-119652778 CCTTCCCTGGCTTGCTTTCTAAT No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969693_1059969697 -9 Left 1059969693 9:119652793-119652815 CCCACAATCCCTAGTGAATCAGC No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data
1059969691_1059969697 23 Left 1059969691 9:119652761-119652783 CCTGGCTTGCTTTCTAATCTCTG No data
Right 1059969697 9:119652807-119652829 TGAATCAGCCAAAAACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969697 Original CRISPR TGAATCAGCCAAAAACTGCA TGG Intergenic
No off target data available for this crispr