ID: 1059969704

View in Genome Browser
Species Human (GRCh38)
Location 9:119652843-119652865
Sequence GAGCTTAATCAGGAGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059969698_1059969704 5 Left 1059969698 9:119652815-119652837 CCAAAAACTGCATGGACCAGTCT No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data
1059969694_1059969704 26 Left 1059969694 9:119652794-119652816 CCACAATCCCTAGTGAATCAGCC No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data
1059969693_1059969704 27 Left 1059969693 9:119652793-119652815 CCCACAATCCCTAGTGAATCAGC No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data
1059969696_1059969704 18 Left 1059969696 9:119652802-119652824 CCTAGTGAATCAGCCAAAAACTG No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data
1059969695_1059969704 19 Left 1059969695 9:119652801-119652823 CCCTAGTGAATCAGCCAAAAACT No data
Right 1059969704 9:119652843-119652865 GAGCTTAATCAGGAGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059969704 Original CRISPR GAGCTTAATCAGGAGTGCCA AGG Intergenic
No off target data available for this crispr