ID: 1059976618

View in Genome Browser
Species Human (GRCh38)
Location 9:119724670-119724692
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059976618_1059976621 1 Left 1059976618 9:119724670-119724692 CCAGAATTATATGCCAGATGCCT No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059976618 Original CRISPR AGGCATCTGGCATATAATTC TGG (reversed) Intergenic
No off target data available for this crispr