ID: 1059976621

View in Genome Browser
Species Human (GRCh38)
Location 9:119724694-119724716
Sequence AAACTCAGCATGTCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059976614_1059976621 27 Left 1059976614 9:119724644-119724666 CCTCAATCTGCACTTTCTCCTGC No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data
1059976615_1059976621 9 Left 1059976615 9:119724662-119724684 CCTGCACCCCAGAATTATATGCC No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data
1059976617_1059976621 2 Left 1059976617 9:119724669-119724691 CCCAGAATTATATGCCAGATGCC No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data
1059976616_1059976621 3 Left 1059976616 9:119724668-119724690 CCCCAGAATTATATGCCAGATGC No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data
1059976618_1059976621 1 Left 1059976618 9:119724670-119724692 CCAGAATTATATGCCAGATGCCT No data
Right 1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059976621 Original CRISPR AAACTCAGCATGTCCCAAAG TGG Intergenic
No off target data available for this crispr