ID: 1059979371

View in Genome Browser
Species Human (GRCh38)
Location 9:119752939-119752961
Sequence GTAATTACCTTGAAGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059979369_1059979371 22 Left 1059979369 9:119752894-119752916 CCAATTACATATACAATATTTTT No data
Right 1059979371 9:119752939-119752961 GTAATTACCTTGAAGAAAACTGG No data
1059979368_1059979371 23 Left 1059979368 9:119752893-119752915 CCCAATTACATATACAATATTTT No data
Right 1059979371 9:119752939-119752961 GTAATTACCTTGAAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059979371 Original CRISPR GTAATTACCTTGAAGAAAAC TGG Intergenic
No off target data available for this crispr