ID: 1059982258

View in Genome Browser
Species Human (GRCh38)
Location 9:119785815-119785837
Sequence CATTCTCAAAATGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059982255_1059982258 -2 Left 1059982255 9:119785794-119785816 CCATGCTGTGTGTCCATGTTACA No data
Right 1059982258 9:119785815-119785837 CATTCTCAAAATGGTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059982258 Original CRISPR CATTCTCAAAATGGTTTTAA AGG Intergenic
No off target data available for this crispr