ID: 1059999893

View in Genome Browser
Species Human (GRCh38)
Location 9:119948768-119948790
Sequence CTGGACTATGAAGGAATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059999893_1059999895 -10 Left 1059999893 9:119948768-119948790 CCTAAGATTCCTTCATAGTCCAG No data
Right 1059999895 9:119948781-119948803 CATAGTCCAGAAATGCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059999893 Original CRISPR CTGGACTATGAAGGAATCTT AGG (reversed) Intergenic
No off target data available for this crispr