ID: 1060000047

View in Genome Browser
Species Human (GRCh38)
Location 9:119950349-119950371
Sequence AGCTGAAGAGATTTTAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060000044_1060000047 28 Left 1060000044 9:119950298-119950320 CCAGGAGATGCTGAGATGTGCTG No data
Right 1060000047 9:119950349-119950371 AGCTGAAGAGATTTTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060000047 Original CRISPR AGCTGAAGAGATTTTAAGTC AGG Intergenic