ID: 1060000968

View in Genome Browser
Species Human (GRCh38)
Location 9:119958372-119958394
Sequence CCACATCTGCAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060000968_1060000974 22 Left 1060000968 9:119958372-119958394 CCATCCTCACTCTGCAGATGTGG No data
Right 1060000974 9:119958417-119958439 AGGCTTTGATTGCAGCTGCATGG No data
1060000968_1060000973 2 Left 1060000968 9:119958372-119958394 CCATCCTCACTCTGCAGATGTGG No data
Right 1060000973 9:119958397-119958419 ACTGAAAGCTGAGTGGTTGCAGG No data
1060000968_1060000972 -5 Left 1060000968 9:119958372-119958394 CCATCCTCACTCTGCAGATGTGG No data
Right 1060000972 9:119958390-119958412 TGTGGGAACTGAAAGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060000968 Original CRISPR CCACATCTGCAGAGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr