ID: 1060008051

View in Genome Browser
Species Human (GRCh38)
Location 9:120017935-120017957
Sequence CCACACTGCCTTGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060008047_1060008051 2 Left 1060008047 9:120017910-120017932 CCATGTTGGTTCTCTTTCCACCT No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data
1060008044_1060008051 9 Left 1060008044 9:120017903-120017925 CCTGACCCCATGTTGGTTCTCTT No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data
1060008042_1060008051 18 Left 1060008042 9:120017894-120017916 CCATGTTGACCTGACCCCATGTT No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data
1060008041_1060008051 26 Left 1060008041 9:120017886-120017908 CCTGGAAGCCATGTTGACCTGAC No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data
1060008046_1060008051 3 Left 1060008046 9:120017909-120017931 CCCATGTTGGTTCTCTTTCCACC No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data
1060008045_1060008051 4 Left 1060008045 9:120017908-120017930 CCCCATGTTGGTTCTCTTTCCAC No data
Right 1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060008051 Original CRISPR CCACACTGCCTTGCAAAAAC AGG Intergenic
No off target data available for this crispr