ID: 1060009068

View in Genome Browser
Species Human (GRCh38)
Location 9:120027419-120027441
Sequence CAGAGCTACCTCCTTGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060009068_1060009074 -6 Left 1060009068 9:120027419-120027441 CCCCCATCAAGGAGGTAGCTCTG No data
Right 1060009074 9:120027436-120027458 GCTCTGGGCTAAGCAGTCCTCGG No data
1060009068_1060009075 -5 Left 1060009068 9:120027419-120027441 CCCCCATCAAGGAGGTAGCTCTG No data
Right 1060009075 9:120027437-120027459 CTCTGGGCTAAGCAGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060009068 Original CRISPR CAGAGCTACCTCCTTGATGG GGG (reversed) Intergenic
No off target data available for this crispr